Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU083751

Sigma-Aldrich

MISSION® esiRNA

targeting human VCAM1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wybierz wielkość

20 μG
1060,00 zł
50 μG
1910,00 zł

1060,00 zł

Wysyłka zazwyczaj następuje w ciągu 3 tygodni (od 4 do 6 tygodni w przypadku zamówień niestandardowych).
Wszystkie zdjęcia(1)

Wybierz wielkość

Zmień widok
20 μG
1060,00 zł
50 μG
1910,00 zł

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

1060,00 zł

Wysyłka zazwyczaj następuje w ciągu 3 tygodni (od 4 do 6 tygodni w przypadku zamówień niestandardowych).

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGTTGAAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGTTTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTCGTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCAAGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAGTCAAAAGTGTAGCTAATGCTTGATATGTTCAACTGGAGACACTATTTATCTGTGCAAATCCTTGATACTGCTCATCATTCCTTGAGAAAAACAATGAGCTGAGAGGCAGACTTCCCTGAATGTATTGAACTTGGAAAGAAATGCCCATCTATGTCCCTTGCTGTGAGCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000162692

numer dostępu NCBI

NM_080682

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... VCAM1(7412) , VCAM1(7412)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Huilin Ye et al.
Cell death & disease, 9(5), 453-453 (2018-04-20)
Tumor-associated macrophages (TAMs) are frequently found near pancreatic cancer cells, but it is uncertain whether they are involved in pancreatic cancer progression and the Warburg effect. Here, we show that CCL18 secreted by TAMs facilitates malignant progression and induced a
Ryota Takahashi et al.
Scientific reports, 10(1), 21194-21194 (2020-12-05)
Pancreatic cancer is one of the malignant diseases with the worst prognosis. Resistance to chemotherapy is a major difficulty in treating the disease. We analyzed plasma samples from a genetically engineered mouse model of pancreatic cancer and found soluble vascular
Orawin Prangsaengtong et al.
Vascular medicine (London, England), 23(3), 201-211 (2018-04-10)
Lymphangiogenesis is the process of new vessel formation from pre-existing lymphatic vessels. The process mainly involves cell adhesion, migration, and tubule formation of lymphatic endothelial cells. Tumor-induced lymphangiogenesis is an important factor contributing to promotion of tumor growth and cancer
Hai-Jian Sun et al.
Scientific reports, 6, 23596-23596 (2016-03-24)
Vascular smooth muscle cells (VSMCs) are indispensible components in foam cell formation. Salusin-β is a stimulator in the progression of atherosclerosis. Here, we showed that salusin-β increased foam cell formation evidenced by accumulation of lipid droplets and intracellular cholesterol content
Yang Cao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(1), 346-356 (2017-05-24)
The contribution of the inflammatory mediator interleukin-17 (IL-17) in nonsmall cell lung cancer (NSCLC) malignancy has been reported in the literature. MicroRNA-181a-5p (miR-181a-5p) acts as a tumor suppressor which can regulate target gene at the posttranscriptional level. Our study aimed
Wyświetl wszystkie powiązane dokumenty

Questions

Reviews

No rating value

Active Filters

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej