Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU078241

Sigma-Aldrich

MISSION® esiRNA

targeting human TJP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCATTTGAACGCAAGTTTGAAAGTCCTAAATTCAATCACAATCTTCTGCCAAGTGAAACTGCACATAAACCTGACTTGTCTTCAAAAACTCCCACTTCTCCAAAAACTCTTGTGAAATCGCACAGTTTGGCACAGCCTCCTGAGTTTGACAGTGGAGTTGAAACTTTCTCTATCCATGCAGAGAAGCCTAAATATCAAATAAATAATATCAGCACAGTGCCTAAAGCTATTCCTGTGAGTCCTTCAGCTGTGGAAGAGGATGAAGATGAAGATGGTCATACTGTGGTGGCCACAGCCCGAGGCATATTTAACAGCAATGGGGGCGTGCTGAGTTCCATAGAAACTGGTGTTAGTATAATTATCCCTCAAGGAGCCATTCCCGAAGGAGTTGAGCAGGAAATCTATTTCAAGGTCTGCCGGGACAACAGCATCCTTCCACCTT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000104067

numer dostępu NCBI

NM_003257

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TJP1(7082) , TJP1(7082)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mahnaz Ramezanpour et al.
Mediators of inflammation, 2016, 9798206-9798206 (2016-02-24)
Cytokine mediated changes in paracellular permeability contribute to a multitude of pathological conditions including chronic rhinosinusitis (CRS). The purpose of this study was to investigate the effect of interferons and of Th1, Th2, and Th17 cytokines on respiratory epithelium barrier
Robert L Gendron et al.
Molecular vision, 17, 2596-2604 (2011-10-26)
The rainbow smelt (Osmerus mordax), is a teleost fish, which avoids freezing by becoming virtually isosmotic with seawater. The effects that such massive changes in osmolarity have on both its visual system and its highly evolved and specialized circulation are
N T K Vo et al.
Journal of fish diseases, 39(2), 175-188 (2015-02-04)
A cell line, WE-cfin11e, with an epithelial-like morphology was developed from a caudal fin of walleye, Sander vitreus (Mitchill), characterized as distinct from the established walleye caudal fin fibroblast-like cell line, WE-cfin11f, and compared with WE-cfin11f for susceptibility to VHSV
Alexander X Cartagena-Rivera et al.
Nature communications, 8(1), 1030-1030 (2017-10-19)
Maintenance of epithelial tissue integrity requires coordination between cell-cell adherens junctions, tight junctions (TJ), and the perijunctional actomyosin cytoskeleton. Here we addressed the hypothesis that alterations in TJ structure and remodeling of the actomyosin cytoskeleton modify epithelial mechanics. Current methods
Madhavi P Maddugoda et al.
The Journal of cell biology, 178(3), 529-540 (2007-08-01)
Cooperation between cadherins and the actin cytoskeleton controls many aspects of epithelial biogenesis. We report here that myosin VI critically regulates the morphogenesis of epithelial cell-cell contacts. As epithelial monolayers mature in culture, discontinuous cell-cell contacts are initially replaced by
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej