Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU077521

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2C

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCTCATGATGTCTGGCGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCATCCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAGCTCTCGCTAGAGTTCCCCAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACGCCCTGCTATCACCCCAACGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGTCTGCCCTGTATGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGAGAACCCAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAAGTACCTGCAAGAAACCTACTCAAAGCAGGTCACCAGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000175063

numer dostępu NCBI

NM_181801

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... UBE2C(11065) , UBE2C(11065)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Pei-Feng Liu et al.
Diagnostics (Basel, Switzerland), 10(9) (2020-09-10)
Ubiquitin-conjugating enzyme 2C (UBE2C) involves in numerous cellular processes and the tumor progression in many cancers. However, its role in oral squamous cell carcinoma (OSCC) is unclear. We aimed to investigate the role and clinical significance of UBE2C in OSCC.
Xianxing Wang et al.
The FEBS journal, 286(24), 4889-4909 (2019-11-13)
Ubiquitin-conjugating enzyme 2C (UBE2C) is a core ubiquitin-conjugating enzyme in the ubiquitin-proteasome system that promotes cell cycle progression. Previous studies have indicated that UBE2C mediates tumorigenesis and progression in various cancers, but its role in pancreatic ductal adenocarcinoma (PDAC) remains
Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
Ying Wang et al.
Biochemical and biophysical research communications, 534, 597-603 (2020-11-24)
Ubiquitin Conjugating Enzyme E2 C (UBE2C) has a key oncogenic role in many human malignancies, including gastric cancer. However, it remains largely unknow at which level UBE2C expression is altered, as well as what are the downstream targets of UBE2C.
Rui Wang et al.
International journal of oncology, 50(4), 1116-1126 (2017-03-06)
The ubiquitin-conjugating enzyme 2C (UBE2C) is the key component in the ubiquitin proteasome system (UPS) by partnering with the anaphase‑promoting complex (APC/C). A high UBE2C protein expression level has been reported in various types of human tumors. However, little is known about the precise mechanism
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej