Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU076021

Sigma-Aldrich

MISSION® esiRNA

targeting human SPAG9

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTGGTTCTGTTGTTGGAGCAAGTGTATTTTACAAGGATGTTGCTGGTTTGGATACAGAAGGCAGTAAACAGCGAAGTGCCTCTCAGAGTAGTTTAGATAAGTTAGATCAGGAACTTAAGGAACAGCAGAAGGAGTTAAAAAATCAAGAAGAATTATCCAGTCTAGTTTGGATCTGTACCAGCACTCATTCGGCTACAAAAGTTCTTATTATTGATGCTGTTCAACCTGGCAACATCCTAGACAGTTTCACTGTTTGCAACTCTCATGTTCTGTGCATTGCAAGTGTGCCAGGTGCACGAGAAACAGACTACCCTGCAGGAGAAGATCTTTCAGAATCTGGTCAGGTAGACAAAGCATCTTTATGTGGAAGTATGACAAGCAACAGCTCAGCAGAGACAGACAGCCTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000008294

numer dostępu NCBI

NM_003971

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SPAG9(9043) , SPAG9(9043)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Qin Hui Sun et al.
BMC cancer, 20(1), 522-522 (2020-06-07)
microRNAs (miRNAs) play essential roles in the development and progression of gastric cancer (GC). Although aberrant miR-874 expression has been reported in various human cancers, its role in GC remains obscure. miR-874 expression was assessed by real-time quantitative polymerase chain
Hui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(7), 6949-6954 (2014-04-18)
Sperm-associated antigen 9 (SPAG9) was recently reported to be overexpressed in several cancers and associated with the malignant behavior of cancer cells. However, the expression pattern of SPAG9 and its clinical significance in human prostate cancer have not been reported.
Feifei Chen et al.
Oncology reports, 32(6), 2533-2540 (2014-10-14)
Sperm-associated antigen 9 (SPAG9) is a recently characterized oncoprotein involved in the progression of several human malignancies. To elucidate the role of SPAG9 in the development of human prostate cancer (PCa), tissue microarray (TMA) and immunohistochemistry were used to detect
Zhi-Feng Miao et al.
Virchows Archiv : an international journal of pathology, 467(5), 525-533 (2015-08-22)
Sperm associated antigen 9 (SPAG9) protein has been found to play an important role in cancer progression but the involved mechanisms are still obscure. Its clinical significance in human gastric cancers remains unexplored. In the present study, SPAG9 expression was
Luis Bonet-Ponce et al.
Science advances, 6(46) (2020-11-13)
Genetic variation around the LRRK2 gene affects risk of both familial and sporadic Parkinson's disease (PD). However, the biological functions of LRRK2 remain incompletely understood. Here, we report that LRRK2 is recruited to lysosomes after exposure of cells to the

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej