Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU075981

Sigma-Aldrich

MISSION® esiRNA

targeting human NECTIN2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGGACGAGGGCAACTACACTTGCGAGTTTGCCACCTTCCCCAAGGGGTCCGTCCGAGGGATGACCTGGCTCAGAGTCATAGCCAAGCCCAAGAACCAAGCTGAGGCCCAGAAGGTCACGTTCAGCCAGGACCCTACGACAGTGGCCCTCTGCATCTCCAAAGAGGGCCGCCCACCTGCCCGGATCTCCTGGCTCTCATCCCTGGACTGGGAAGCCAAAGAGACTCAGGTGTCAGGGACCCTGGCCGGAACTGTCACTGTCACCAGCCGCTTCACCTTGGTGCCCTCGGGCCGAGCAGATGGTGTCACGGTCACCTGCAAAGTGGAGCATGAGAGCTTCGAGGAACCAGCCCTGATACCTGTGACCCTCTCTGTACGCTACCCTCCTGAAGTGTCCATCTCCGGCTA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000130202

numer dostępu NCBI

NM_002856

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... NECTIN2(5819) , PVRL2(5819)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Fabian Wolpert et al.
PloS one, 10(10), e0139603-e0139603 (2015-10-07)
Immunotherapy targeting glioblastoma initiating cells (GIC) is considered a promising strategy. However, GIC are prone to evade immune response and there is a need for potent adjuvants. IFN-β might enhance the immune response and here we define its net effect
Elisabeth Devilard et al.
PloS one, 8(10), e77424-e77424 (2013-10-12)
Lymphocyte trafficking and migration through vascular endothelial cells (ECs) in secondary lymphoid tissues is critical for immune protection. In the present study, we investigate the role of nectin cell adhesion molecules for the migration of lymphocytes through ECs. Nectins are
Benjamin Murter et al.
Cancer immunology research, 7(2), 244-256 (2019-01-20)
A limitation to antitumor immunity is the dysfunction of T cells in the tumor microenvironment, in part due to upregulation of coinhibitory receptors such as PD-1. Here, we describe that poliovirus receptor-related immunoglobulin domain protein (PVRIG) acts as a coinhibitory
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej