Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU075501

Sigma-Aldrich

MISSION® esiRNA

targeting human CUX1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AAGCAAGGAAGCTGAAGCAGCTTTCTTGAATGTCTACAAAAGATTGATTGACGTCCCAGATCCCGTACCAGCTTTGGATCTCGGACAGCAACTCCAGCTCAAAGTGCAGCGCCTGCACGATATTGAAACAGAGAACCAGAAACTTAGGGAAACTCTGGAAGAATACAACAAGGAATTTGCTGAAGTGAAAAATCAAGAGGTTACGATAAAAGCACTTAAAGAGAAAATCCGAGAATATGAACAGACACTGAAGAACCAAGCCGAAACCATAGCTCTTGAGAAGGAACAGAAGTTACAGAATGACTTTGCAGAAAAGGAGAGAAAGCTGCAGGAGACACAGATGTCCACCACCTCAAAGCTGGAGGAAGCTGAGCATAAGGTTCAGAGCCTACAAACAGCCCTGGAAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000160967

numer dostępu NCBI

NM_001913

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CUX1(1523) , CUX1(1523)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Liza J Burton et al.
PloS one, 14(4), e0214844-e0214844 (2019-04-10)
Triple-Negative Breast Cancers (TNBCs) are the most difficult to treat subtype of breast cancer and are often associated with high nuclear expression of Snail and Cathepsin L (Cat L) protease. We have previously shown that Snail can increase Cat L
Xiao Zhang et al.
Neurochemical research, 45(12), 2840-2855 (2020-10-02)
Circular RNAs (circRNAs) played pivotal roles in the initiation and progression of cancers. CircRNA cut like homeobox 1 (circ-CUX1; hsa_circ_0132813) has been reported to contribute to neuroblastoma (NB) development by previous study. Furthermore, previous works reported that microRNA-16-5p (miR-16-5p) was
Junfeng Wang et al.
Oncology reports, 37(5), 3068-3074 (2017-04-14)
The homeobox transcription factor CUTL1 has been associated with cellular proliferation and cell cycle progression, and CUTL1 functions as an oncogene. The aim of the present study was to investigate whether CUTL1 participates in epithelial-mesenchymal transition (EMT). The expression levels
Tian Gao et al.
Cancer biology & medicine, 17(2), 371-386 (2020-06-27)
Objective: Osteosarcoma is a common primary highly malignant bone tumor. Kinesin family member 18B (KIF18B) has been identified as a potential oncogene involved in the development and metastasis of several cancer types. While KIF18B overexpression in osteosarcoma tissue is clearly

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej