Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU072661

Sigma-Aldrich

MISSION® esiRNA

targeting human MLKL

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGGACACATCCCACTCCAAATGATATTTCCAAAAACATACCTCTGACAGTAACTTTGATAGATGGTTTGTCAAATGTATCTTTCTGGGTATCCACACCTCTTGGCAATGAAATTTGCAGCTCCTCCCTTCCATAAATGAAGTCTCTTTCCCCACCATTTGAATCTGGGCTGGCACTGTGACTTGATTTGATCAATAGAATGTGGAAGAAGTGACTGTATGCCAGTTCCAAGCCTAGGTTTCAAGAGGCCTTATAAATGTCTGTTGGAACCTTACCCAGCCATGAACATGTTGAGTGAGCATGCTGGAGAATGAGAGACCACATGAAGCAGAAACATGCTTTCCTAGCTGAAGTCATACTAGCCCAACCAACATGGCAGCTAACACATGAATGAGGCCAATCAAGACCAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000168404

numer dostępu NCBI

NM_152649

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MLKL(197259) , MLKL(197259)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Piotr T Filipczak et al.
Cancer research, 76(24), 7130-7139 (2016-10-21)
Tuberous sclerosis complex (TSC) is a genetic multiorgan disorder characterized by the development of neoplastic lesions in kidney, lung, brain, heart, and skin. It is caused by an inactivating mutation in tumor suppressor genes coding the TSC1/TSC2 complex, resulting in
Chengkui Yang et al.
Cell death & disease, 8(10), e3084-e3084 (2017-10-06)
Receptor-interacting kinase-3 (RIP3) is a key regulator of necroptosis. It has been shown that the expression of RIP3 is silenced in most cancer cells and tissues due to genomic methylation. However, the regulatory mechanisms controlling RIP3 expression in cancer cells
Yu Xiong et al.
Cell death and differentiation, 26(10), 1929-1941 (2019-01-16)
Necroptosis is a programmed form of necrotic cell death, which is tightly regulated by the necroptotic signaling pathway containing receptor-interacting protein (RIP)1, RIP3, and mixed-lineage kinase domain-like (MLKL) protein. In addition to the RIP1-RIP3-MLKL axis, other factors regulating necroptosis are
Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej