Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU069091

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP2A2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000174437

numer dostępu NCBI

NM_170665

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ATP2A2(488) , ATP2A2(488)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jie Tong et al.
Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)
The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a
Cheol Yi Hong et al.
Experimental & molecular medicine, 48(8), e253-e253 (2016-08-20)
The migration of dendritic cells (DCs) to secondary lymphoid organs depends on chemoattraction through the interaction of the chemokine receptors with chemokines. However, the mechanism of how lymphoid chemokines attract DCs to lymphoid organs remains unclear. Here, we demonstrate the
Eduardo Izquierdo-Torres et al.
Molecular carcinogenesis, 56(7), 1703-1711 (2017-02-06)
The Ca
Feng Huang et al.
Journal of cancer research and clinical oncology, 140(11), 1835-1848 (2014-06-19)
This study was designed to investigate the role of PDGF-DD secreted by gastric cancer-derived mesenchymal stem cells (GC-MSCs) in human gastric cancer progression. Gastric cancer cells were indirectly co-cultured with GC-MSCs in a transwell system. The growth and migration of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej