Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU068551

Sigma-Aldrich

MISSION® esiRNA

targeting human YTHDF2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACTTGAGTCCACAGGCAAGGCCCAATAATGCATATACTGCCATGTCAGATTCCTACTTACCCAGTTACTACAGTCCCTCCATTGGCTTCTCCTATTCTTTGGGTGAAGCTGCTTGGTCTACGGGGGGTGACACAGCCATGCCCTACTTAACTTCTTATGGACAGCTGAGCAACGGAGAGCCCCACTTCCTACCAGATGCAATGTTTGGGCAACCAGGAGCCCTAGGTAGCACTCCATTTCTTGGTCAGCATGGTTTTAATTTCTTTCCCAGTGGGATTGACTTCTCAGCATGGGGAAATAACAGTTCTCAGGGACAGTCTACTCAGAGCTCTGGATATAGTAGCAATTATGCTTATGCACCTAGCTCCTTAGGTGGAGCCATGATTGATGGACAGTCAGCTTTTGCCAATGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000198492

numer dostępu NCBI

NM_016258

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... YTHDF2(51441) , YTHDF2(51441)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Chuanzhao Zhang et al.
Oncogene, 39(23), 4507-4518 (2020-05-06)
N6-methyladenosine (m6A) RNA methylation contributes to the cancer stem cell (CSC) phenotype through regulating gene expression. YTHDF2, an m6A reader, was shown to be associated with hepatocellular carcinoma (HCC) patient prognosis. However, the effect of YTHDF2 on liver CSC and
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Sara Zaccara et al.
Cell, 181(7), 1582-1595 (2020-06-04)
N6-methyladenosine (m6A) is the most abundant mRNA nucleotide modification and regulates critical aspects of cellular physiology and differentiation. m6A is thought to mediate its effects through a complex network of interactions between different m6A sites and three functionally distinct cytoplasmic
Ye Fu et al.
Nature chemical biology, 16(9), 955-963 (2020-05-27)
Diverse RNAs and RNA-binding proteins form phase-separated, membraneless granules in cells under stress conditions. However, the role of the prevalent mRNA methylation, m6A, and its binding proteins in stress granule (SG) assembly remain unclear. Here, we show that m6A-modified mRNAs
Gaocai Li et al.
Cell death & disease, 11(2), 103-103 (2020-02-08)
N6 methyladenosine (m6A) is one of the most prevalent epitranscriptomic modifications of mRNAs, and plays a critical role in various bioprocesses. Bone-derived mesenchymal stem cells (BMSCs) can attenuate apoptosis of nucleus pulposus cells (NPCs) under compression; however, the underlying mechanisms
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej