Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU065101

Sigma-Aldrich

MISSION® esiRNA

targeting human TRO

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACAAAGATCCCCATCAAACGCTCAGACATGCTGAGGGATGTCATCCAAGAATATGATGAATATTTCCCAGAAATCATTGAACGAGCAAGCTACACTCTGGAGAAGATGTTTCGAGTCAATCTGAAAGAAATTGATAAGCAAAGTAGCTTGTATATTCTCATCAGCACTCAGGAATCCTCTGCAGGCATACTGGGAACGACCAAGGACACACCCAAGCTGGGTCTCCTCATGGTGATTCTGAGTGTCATTTTTATGAATGGCAACAAGGCCAGTGAGGCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGGTGAGGCATTCACTCTTTGGGGAAGTGAGGAAGCTCATCACAGACGAGTTTGTGAAGCAGAAGTACCTGGAGTACAAGAGGGTCCCTAACAGCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Guoshuai Cao et al.
Cancer communications (London, England), 41(1), 51-61 (2021-07-09)
The interaction between activating receptor NKp30 and its major tumor ligand B7-H6 is important for NK cell-mediated tumor rejection. However, the regulation of B7-H6 by tumor therapeutics remains largely unknown. In this study, we investigated the regulation of B7-H6 by
Hongyong Fu et al.
Molecular therapy. Nucleic acids, 12, 769-786 (2018-08-25)
Spermatogonial stem cells (SSCs) have significant applications in reproductive and regenerative medicine. However, nothing is known about genes in mediating human SSCs. Here we have explored for the first time the function and mechanism of P21-activated kinase 1 (PAK1) in
Min Young Ahn et al.
Journal of vascular research, 55(2), 75-86 (2018-02-07)
Thrombospondin-1 (TSP-1) is implicated in vascular diseases associated with oxidative stress, such as abdominal aortic aneurysms, ischemia-reperfusion injury, and atherosclerosis. However, the regulatory mechanisms underlying TSP-1 expression are not fully elucidated. In this study, we found that peroxisome proliferator-activated receptor

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej