Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU062201

Sigma-Aldrich

MISSION® esiRNA

targeting human EED

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGAAGTCAAAGAAATGCAAATATTCTTTCAAATGTGTAAATAGTCTCAAGGAAGATCATAACCAACCATTGTTTGGAGTTCAGTTTAACTGGCACAGTAAAGAAGGAGATCCATTAGTGTTTGCAACTGTAGGAAGCAACAGAGTTACCTTGTATGAATGTCATTCACAAGGAGAAATCCGGTTGTTGCAATCTTACGTGGATGCTGATGCTGATGAAAACTTTTACACTTGTGCATGGACCTATGATAGCAATACGAGCCATCCTCTGCTGGCTGTAGCTGGATCTAGAGGCATAATTAGGATAATAAATCCTATAACAATGCAGTGTATAAAGCACTATGTTGGCCATGGAAATGCTATCAATGAGCTGAAATTCCATCCAAGAGATCCAAATCTTCTCCTGTCAGTAAGTAAAGATCATGCTTTACGATTATGGAATATCCAGACGGACACTCTGGTGGCAATATTTGGAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000074266

numer dostępu NCBI

NM_152991

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... EED(8726) , EED(8726)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Bing He et al.
Oncotarget, 8(61), 103919-103930 (2017-12-22)
The miRNAs play important regulating roles in the pathogenesis of hepatocellular carcinoma (HCC). To uncover key regulating miRNAs in HCC that were neglected by traditional analyzing methods of transcriptomics data, we proposed a novel molecular-network-based omics' (MNBO) method. With this
Qipeng Liu et al.
International journal of cancer, 145(2), 415-426 (2019-01-11)
Polycomb group proteins are important epigenetic regulators for cell proliferation and differentiation, organ development, as well as initiation and progression of lethal diseases, including cancer. Upregulated Polycomb group proteins, including Enhancer of zeste homolog 2 (EZH2), promote proliferation, migration, invasion
Houliang Deng et al.
Scientific reports, 9(1), 197-197 (2019-01-19)
Chromobox 6 (CBX6) is a subunit of Polycomb Repressive Complex 1 (PRC1) that mediates epigenetic gene repression and acts as an oncogene or tumor suppressor in a cancer type-dependent manner. The specific function of CBX6 in breast cancer is currently
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej