Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU062171

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGCCAAGCATAAGGTCTGCCGAAGCCTTGGCGTTCTCAGACTGCCGGCTGCACATCTGCCTGTACTACCGGGAAATCCTCGTGAAGGAGCTGACCACGTCCAGCCCCGAGGGCTGCCGGATCTCCCATGGACATACGTATGACGCCAGCAACCTGGACCAGGTCCTGTTCCCCTACCCAGAGGACAATGGCCAGAGGAAAAACATTGAGAAGCTGCTGAGCCACCTGGAGAGGGGCGTGGTCCTCTGGATGGCCCCCGACGGGCTCTATGCGAAAAGACTGTGCCAGAGCAGGATCTACTGGGACGGGCCCCTGGCGCTGTGCAACGACCGGCCCAACAAACTGGAGAGAGACCAGACCTGCAAGCTCTTTGACACACAGCAGTTCTTGTCAGAGCTGCAAGCGTTTGCTCACCACGGCCGCTCCCTGCCAAGATTCCAGGTGACTCTATGCTTTGGAGAGGAGTTTCCAGACCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000137265

numer dostępu NCBI

NM_002460

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IRF4(3662) , IRF4(3662)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Takuya Yashiro et al.
Scientific reports, 9(1), 1161-1161 (2019-02-06)
The chemokine CCL22 is predominantly produced by dendritic cells (DCs) and macrophages. CCL22 acts on CCR4-expressing cells including Th2 and Treg. Although a correlation between the CCL22-CCR4 axis and allergic diseases has been established, the mechanism of monocyte lineage-specific Ccl22
T Watanabe et al.
Mucosal immunology, 7(6), 1312-1325 (2014-03-29)
It is well established that polymorphisms of the caspase activation and recruitment domain 15 (CARD15) gene, a major risk factor in Crohn's disease (CD), lead to loss of nucleotide-binding oligomerization domain 2 (NOD2) function. However, a molecular explanation of how
Sorim Nam et al.
Journal of leukocyte biology, 100(6), 1273-1284 (2016-09-08)
Myeloid-derived suppressor cells (MDSCs) are immature cells that do not differentiate into mature myeloid cells. Two major populations of PMN-MDSCs (Ly6G
Takuya Yashiro et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 11481-11491 (2019-07-18)
C-C chemokine receptor type 7 (CCR7) is essential for migration of dendritic cells (DCs) to draining lymph nodes. PU.1/Spi1 is a transcription factor playing a critical role in the gene regulation of DCs. PU.1 knockdown decreased the expression of CCR7
Diego Barriales et al.
PLoS biology, 19(1), e3001062-e3001062 (2021-01-05)
Lyme carditis is an extracutaneous manifestation of Lyme disease characterized by episodes of atrioventricular block of varying degrees and additional, less reported cardiomyopathies. The molecular changes associated with the response to Borrelia burgdorferi over the course of infection are poorly
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej