Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU060511

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHB2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCACACCCAGTACACCTTCGAGATCCAGGCTGTGAACGGCGTTACTGACCAGAGCCCCTTCTCGCCTCAGTTCGCCTCTGTGAACATCACCACCAACCAGGCAGCTCCATCGGCAGTGTCCATCATGCATCAGGTGAGCCGCACCGTGGACAGCATTACCCTGTCGTGGTCCCAGCCGGACCAGCCCAATGGCGTGATCCTGGACTATGAGCTGCAGTACTATGAGAAGGAGCTCAGTGAGTACAACGCCACAGCCATAAAAAGCCCCACCAACACGGTCACCGTGCAGGGCCTCAAAGCCGGCGCCATCTATGTCTTCCAGGTGCGGGCACGCACCGTGGCAGGTTACGGGCGCTACAGCGGCAAGATGTACTTCCAGACCATGACAGAAGCCGAGTACCAGACAAGCATCCAGGAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Walaiporn Khansaard et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(10), 10031-10041 (2014-07-12)
The activation of Ephrin (Eph) receptors, the largest tyrosine kinase families of cell surface receptor, has recently been addressed in human cholangiocarcinoma (CCA). Therefore, the present study aimed to investigate the role of Eph receptors and its ligands in CCA.
Young Hyun Jung et al.
Biochimica et biophysica acta, 1853(8), 1905-1917 (2015-05-13)
The role of unsaturated fatty acids (UFAs) is essential for determining stem cell functions. Eph/Ephrin interactions are important for regulation of stem cell fate and localization within their niche, which is significant for a wide range of stem cell behavior.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej