Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU058281

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP6

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCTGTTGCAGAGGAGAATCCTAAGGAGAGTAAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAATCCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATGGGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGAGGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAGTGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAGTCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGCTAAAGCTGGGGGATAGAGGGGCTGCAGGGCCACTGGAAGGAACATGGAGCTGTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000167779

numer dostępu NCBI

NM_002178

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IGFBP6(3489) , IGFBP6(3489)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 688-692 (2018-03-28)
IGFBP6 gene plays an important role in the pathogenesis of breast cancer. In this work, we performed knockdown of IGFBP6 gene in MDA-MB-231 cells and obtained a stable cell line. Knockdown of IGFBP6 gene was confirmed by the real-time PCR.
S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 650-654 (2018-03-27)
Protein IGFBP6 plays an important role in the pathogenesis of many malignant tumors, including breast cancer. The relationship between IGFBP6 protein and the expression of genes associated with the epithelial-mesenchymal transition is studied. Gene IGFBP6 knockdown does not trigger the
Song Wang et al.
Neurochemical research, 42(2), 455-467 (2016-11-27)
IGFBP6, a member of the insulin-like growth factor-binding proteins family that contains six high affinity IGFBPs, modulates insulin-like growth factor (IGF) activity and also showed an independent effect of IGF, such as growth inhibition and apoptosis. However, the role of
Zhecun Wang et al.
Journal of cellular physiology, 235(12), 9538-9556 (2020-06-13)
Despite the high prevalence of varicose veins, the underlying pathogenesis of this disease remains unclear. The present study aims to explore the role of insulin-like growth factor binding protein 6 (IGFBP6) in vascular smooth muscle cells (VSMCs). Using a protein
Keigo Sawada et al.
Biochemical and biophysical research communications, 464(1), 299-305 (2015-06-28)
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej