Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU055701

Sigma-Aldrich

MISSION® esiRNA

targeting human NPY

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTCGCCCGACAGCATAGTACTTGCCGCCCAGCCACGCCCGCGCGCCAGCCACCATGCTAGGTAACAAGCGACTGGGGCTGTCCGGACTGACCCTCGCCCTGTCCCTGCTCGTGTGCCTGGGTGCGCTGGCCGAGGCGTACCCCTCCAAGCCGGACAACCCGGGCGAGGACGCACCAGCGGAGGACATGGCCAGATACTACTCGGCGCTGCGACACTACATCAACCTCATCACCAGGCAGAGATATGGAAAACGATCCAGCCCAGAGACACTGATTTCAGACCTCTTGATGAGAGAAAGCACAGAAAATGTTCCCAGAACTCGGCTTGAAGACCCTGCAATGTGGTGATGGGAAATGAGACTTGCTCTCTGGCCTTTTCCTA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000122585

numer dostępu NCBI

NM_000905

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... NPY(4852) , NPY(4852)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Cheni-Chery Sudhakumari et al.
General and comparative endocrinology, 251, 54-65 (2017-03-23)
Neuropeptide-Y (NPY) has diverse physiological functions which are extensively studied in vertebrates. However, regulatory role of NPY in relation to brain ontogeny and recrudescence with reference to reproduction is less understood in fish. Present report for the first time evaluated
Claire B de La Serre et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 311(5), R930-R939 (2016-11-03)
Increased neuropeptide Y (NPY) gene expression in the dorsomedial hypothalamus (DMH) has been shown to cause hyperphagia, but the pathway underlying this effect remains less clear. Hypothalamic neural systems play a key role in the control of food intake, in
Sung-Hyeok Hong et al.
Oncotarget, 6(9), 7151-7165 (2015-02-26)
Ewing sarcoma (ES) develops in bones or soft tissues of children and adolescents. The presence of bone metastases is one of the most adverse prognostic factors, yet the mechanisms governing their formation remain unclear. As a transcriptional target of EWS-FLI1
Min Hee Park et al.
The EMBO journal, 34(12), 1648-1660 (2015-04-29)
Many reports have revealed the importance of the sympathetic nervous system (SNS) in the control of the bone marrow environment. However, the specific role of neuropeptide Y (NPY) in this process has not been systematically studied. Here we show that

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej