Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU054741

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKD1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGCTTCTGAAGGGGCTTTTCAGGCAGGGCTTGCAGTGCAAAGATTGCAGATTCAACTGCCATAAACGTTGTGCACCGAAAGTACCAAACAACTGCCTTGGCGAAGTGACCATTAATGGAGATTTGCTTAGCCCTGGGGCAGAGTCTGATGTGGTCATGGAAGAAGGGAGTGATGACAATGATAGTGAAAGGAACAGTGGGCTCATGGATGATATGGAAGAAGCAATGGTCCAAGATGCAGAGATGGCAATGGCAGAGTGCCAGAACGACAGTGGCGAGATGCAAGATCCAGACCCAGACCACGAGGACGCCAACAGAACCATCAGTCCATCAACAAGCAACAATATCCCACTCATGAGGGTAGTGCAGTCTGTCAAACACACGAAGAGGAAAAGCAGCAC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kimberly A Coughlan et al.
The Journal of biological chemistry, 291(11), 5664-5675 (2016-01-23)
AMP-activated protein kinase (AMPK) is an energy-sensing enzyme whose activity is inhibited in settings of insulin resistance. Exposure to a high glucose concentration has recently been shown to increase phosphorylation of AMPK at Ser(485/491) of its α1/α2 subunit; however, the
Qi Zhou et al.
Archives of toxicology, 93(6), 1639-1648 (2019-04-26)
2,3',4,4',5-Pentachlorobiphenyl (PCB118) has been shown to cause thyroidal ultrastructure lesions, but the underlying mechanism remains elusive. This study aimed to elucidate the mechanism by which PCB118 induces the abnormalities of the thyrocytes. Wistar rats were injected intraperitoneally with PCB118 (0
Di Zhao et al.
International journal of biological sciences, 13(3), 276-285 (2017-04-04)
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively
Jia Wang et al.
American journal of physiology. Cell physiology, 310(7), C542-C557 (2016-01-08)
Given the fundamental role of β-catenin signaling in intestinal epithelial cell proliferation and the growth-promoting function of protein kinase D1 (PKD1) in these cells, we hypothesized that PKDs mediate cross talk with β-catenin signaling. The results presented here provide several
Jonathan Baker et al.
PloS one, 13(4), e0195864-e0195864 (2018-04-14)
Many catabolic stimuli, including interleukin-1 (IL-1) in combination with oncostatin M (OSM), promote cartilage breakdown via the induction of collagen-degrading collagenases such as matrix metalloproteinase 1 (MMP1) and MMP13 in human articular chondrocytes. Indeed, joint diseases with an inflammatory component

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej