Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU046211

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF2C

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTTCGGGCTACTTTGGAATGTCATCCACTTACTATGACTGATCCTATCGAAGAGCACAGAATATGTGTCTGTGTTAGGAAACGCCCACTGAATAAGCAAGAATTGGCCAAGAAAGAAATTGATGTGATTTCCATTCCTAGCAAGTGTCTCCTCTTGGTACATGAACCCAAGTTGAAAGTGGACTTAACAAAGTATCTGGAGAACCAAGCATTCTGCTTTGACTTTGCATTTGATGAAACAGCTTCGAATGAAGTTGTCTACAGGTTCACAGCAAGGCCACTGGTACAGACAATCTTTGAAGGTGGAAAAGCAACTTGTTTTGCATATGGCCAGACAGGAAGTGGCAAGACACATACTATGGGCGGAGACCTCTCTGGGAAAGCCCAGAATGCATCCAAAGGGAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000142945

numer dostępu NCBI

NM_006845

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... KIF2C(11004) , KIF2C(11004)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Haibo Wang et al.
Oncotarget, 8(30), 48671-48687 (2017-04-19)
Defects in resolving kinetochore-microtubule attachment mistakes during mitosis is linked to chromosome instability associated with carcinogenesis as well as resistance to cancer therapy. Here we report for the first time that tumor suppressor p53-binding protein 1 (53BP1) is phosphorylated at
Ashley Mooneyham et al.
Molecular cancer research : MCR, 17(2), 370-383 (2018-10-17)
UNC-45A, a highly conserved member of the UCS (UNC45A/CRO1/SHE4P) protein family of cochaperones, plays an important role in regulating cytoskeletal-associated functions in invertebrates and mammalian cells, including cytokinesis, exocytosis, cell motility, and neuronal development. Here, for the first time, UNC-45A
Chenyu Li et al.
Scientific reports, 6, 18773-18773 (2016-01-07)
Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule
Rui-Chao Chai et al.
Carcinogenesis, 40(10), 1229-1239 (2019-06-04)
1p/19q codeletion, which leads to the abnormal expression of 1p19q genes in oligodendroglioma, is associated with chemosensitivity and favorable prognosis. Here, we aimed to explore the clinical implications of 1p19q gene expression in 1p/19q non-codel gliomas. We analyzed expression of
Hengyi Shao et al.
Scientific reports, 5, 12204-12204 (2015-07-25)
Chromosome segregation in mitosis is orchestrated by the dynamic interactions between the kinetochore and spindle microtubules. The microtubule depolymerase mitotic centromere-associated kinesin (MCAK) is a key regulator for an accurate kinetochore-microtubule attachment. However, the regulatory mechanism underlying precise MCAK depolymerase
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej