Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU044751

Sigma-Aldrich

MISSION® esiRNA

targeting human MACC1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAAGGTGATTTCAAAGGAGCAAGTAATGTTTATGTCAGATAGTGTCTTTACAACCAGAAATCTTCTTGAACAGATTGTCCTGCCTTTAAAAAAATTGACTTATATCTACTCAGTTGTATTAACCTTGGTGTCAGAAAAAGTTTATGATTGGAAAGTTTTAGCTGATGTCCTGGGTTACTCACATCTGTCCCTGGAAGATTTTGATCAAATTCAAGCAGACAAAGAATCAGAGAAAGTTTCTTATGTTATAAAGAAGTTAAAGGAAGATTGCCACACAGAGAGAAATACAAGGAAGTTTCTGTATGAACTTATTGTGGCTCTTCTGAAAATGGATTGCCAAGAGTTAGTCGCACGTCTCATCCAAGAAGCTGCTGTTCTGACTTCAGCTGTCAAGCTTGGAAAAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000183742

numer dostępu NCBI

NM_182762

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MACC1(346389) , MACC1(346389)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

C J Wei et al.
Neoplasma, 67(3), 537-546 (2020-02-18)
Gastric cardia adenocarcinoma (GCA) is one of the most common types of cancer and the incidence is increasing globally. MicroRNAs (miRNAs) have been reported to play critical roles in the progression of GCA. However, the exact role of miR-638 in
Qiang Zhang et al.
Acta biochimica et biophysica Sinica, 50(8), 748-756 (2018-07-03)
One of the major obstacles hindering the treatment of lung cancer (LC) is chemoresistance; however, its mechanism remains unclear. The overexpression of the metastasis-associated in colon cancer 1 (MACC1) gene has been demonstrated to reverse chemoresistance. In the current study
Mingliang Lu et al.
Experimental and therapeutic medicine, 17(4), 2807-2814 (2019-03-25)
The mortality and incidence rates of colorectal cancer (CRC) vary widely worldwide. miR-338-3p inhibits tumor cell proliferation in several types of cancer, however, the role of miR-338-3p on CRC remains unknown. The aim of the current study was to investigate
Yaoqing Li et al.
Molecular medicine reports, 12(1), 426-434 (2015-03-05)
Metastasis-associated in colon cancer-1 (MACC1) is a newly identified gene that is involved in the development and progression of hepatocellular carcinoma (HCC), however its investigation has not been comprehensive. In the present study, in vitro techniques, including immunohistochemistry, western blotting
Aiko Sueta et al.
International journal of oncology, 46(5), 2143-2153 (2015-03-05)
The newly identified gene, metastasis‑associated in colon cancer 1 (MACC1), is suggested to be a transcriptional regulator of c‑Met, leading to cancer progression in colorectal cancer. To date however, little is known of the role of MACC1 in breast cancer.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej