Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU043331

Sigma-Aldrich

MISSION® esiRNA

targeting human SUZ12

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAAGGCAACAAACTGAAGCAAGAGATGACCTGCATTGCCCTTGGTGTACTCTGAACTGCCGCAAACTTTATAGTTTACTCAAGCATCTTAAACTCTGCCATAGCAGATTTATCTTCAACTATGTTTATCATCCAAAAGGTGCTAGGATAGATGTTTCTATCAATGAGTGTTATGATGGCTCCTATGCAGGAAATCCTCAGGATATTCATCGCCAACCTGGATTTGCTTTTAGTCGCAACGGACCAGTTAAGAGAACACCTATCACACATATTCTTGTGTGCAGGCCAAAACGAACAAAAGCAAGCATGTCTGAATTTCTTGAATCTGAAGATGGGGAAGTAGAACAGCAAAGAACATATAGTAGTGGCCACAATCGTCTGTATTTCCATAGTGATACCTGCTTACCTCTCCGTCCACAAGAAATGGAAGTAGATAGTGAAGATGAAAAGGATCCTGAATGGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000178691

numer dostępu NCBI

NM_015355

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SUZ12(23512) , SUZ12(23512)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Young Hwa Soung et al.
Cancers, 12(8) (2020-08-14)
Triple-negative breast cancers (TNBCs) lack ER, PR and her2 receptors that are targets of common breast cancer therapies with poor prognosis due to their high rates of metastasis and chemoresistance. Based on our previous studies that epigenetic silencing of a
Xiaoli Wei et al.
Oncology letters, 18(2), 1607-1616 (2019-08-20)
Chemotherapy resistance is a major obstacle to the effective treatment of patients with gastric cancer (GC). Mounting evidence has indicated that the dysregulation of microRNAs (miRNAs) is associated with the sensitivity of cancer cells to chemotherapy. However, the mechanisms underlying
Lin Jin et al.
Cancer research, 77(20), 5464-5478 (2017-08-23)
NOTCH signaling exerts essential roles in normal and malignant intestinal physiology and the homeostasis of cancer stem-like cells (CSC), but the basis for this latter role remains obscure. The signaling scaffold protein STRAP is upregulated in several cancers, where it
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej