Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU039821

Sigma-Aldrich

MISSION® esiRNA

targeting human LGR5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCACTCCCTGGGAAAGAAATGCTTTGATGGGCTCCACAGCCTAGAGACTTTAGATTTAAATTACAATAACCTTGATGAATTCCCCACTGCAATTAGGACACTCTCCAACCTTAAAGAACTAGGATTTCATAGCAACAATATCAGGTCGATACCTGAGAAAGCATTTGTAGGCAACCCTTCTCTTATTACAATACATTTCTATGACAATCCCATCCAGTTTGTTGGGAGATCTGCTTTTCAACATTTACCTGAACTAAGAACACTGACTCTGAATGGTGCCTCACAAATAACTGAATTTCCTGATTTAACTGGAACTGCAAACCTGGAGAGTCTGACTTTAACTGGAGCACAGATCTCATCTCTTCCTCAAACCGTCTGCAATCAGTTACCTAATCTCCAAGTGCTAGATCTGTCTTACAACCTATTAGAAGATTTACCCAGTTTTTCAGTCTGCCAAAAGCTTCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000139292

numer dostępu NCBI

NM_003667

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... LGR5(8549) , LGR5(8549)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiangfei Wang et al.
Oncogenesis, 7(8), 57-57 (2018-08-10)
LGR5 plays a critical role in tissue development and the maintenance of adult stem cells in gastrointestinal tract. However, the oncogenic role of LGR5 in the development of gastric adenocarcinoma remains elusive. Here, we show that LGR5 promotes gastric adenocarcinoma
Bo Gun Jang et al.
The American journal of pathology, 188(10), 2236-2250 (2018-07-24)
We investigated the expression profile of leucine-rich, repeat-containing, G-protein-coupled receptor 5 (LGR5) during colorectal cancer (CRC) progression and determined the prognostic impact of LGR5 in a large cohort of CRC samples. LGR5 expression was higher in CRCs than in normal
Lalarukh Haris Shaikh et al.
The Journal of clinical endocrinology and metabolism, 100(6), E836-E844 (2015-04-29)
Aldosterone synthesis and cellularity in the human adrenal zona glomerulosa (ZG) is sparse and patchy, presumably due to salt excess. The frequency of somatic mutations causing aldosterone-producing adenomas (APAs) may be a consequence of protection from cell loss by constitutive
Johannes Gojo et al.
Cancer cell, 38(1), 44-59 (2020-07-15)
Ependymoma is a heterogeneous entity of central nervous system tumors with well-established molecular groups. Here, we apply single-cell RNA sequencing to analyze ependymomas across molecular groups and anatomic locations to investigate their intratumoral heterogeneity and developmental origins. Ependymomas are composed

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej