Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU034511

Sigma-Aldrich

MISSION® esiRNA

targeting human TBK1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCGGCTGGTATAACAAGAGGATTGCCTGATCCAGCCAAGATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACTGCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTTAATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAAAAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGACATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAACCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTGGGTGGAATGAAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000183735

numer dostępu NCBI

NM_013254

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TBK1(29110) , TBK1(29110)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
ADV
JUU
QCS
KBU
IYT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kaixuan Cui et al.
Biochemical and biophysical research communications, 503(1), 202-208 (2018-06-05)
choroidal neovascularization (CNV), a characteristic of wet age-related macular degeneration (AMD), causes severe vision loss among elderly patients. TANK-binding kinase 1 (TBK1) is a ubiquitously expressed serine-threonine kinase and is found to induce endothelial cells proliferation, represent a novel mediator
Yanyu Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(7), 7822-7832 (2019-03-27)
Platelets can promote several stages of the metastatic process and thus contribute to malignant progression. As an example, platelets promote invasive properties of tumor cells by induction of epithelial to mesenchymal transition (EMT). In this study, we show that tumor
Chaping Cheng et al.
Theranostics, 8(17), 4633-4648 (2018-10-04)
Tumor metastasis is the major cause of death for prostate cancer (PCa) patients. However, the treatment options for metastatic PCa are very limited. Epithelial-mesenchymal transition (EMT) has been reported to be an indispensable step for tumor metastasis and is suggested
Yong Cheng et al.
EMBO reports, 20(3) (2019-01-27)
Extracellular vesicles (EVs) have been shown to carry microbial components and function in the host defense against infections. In this study, we demonstrate that Mycobacterium tuberculosis (M.tb) RNA is delivered into macrophage-derived EVs through an M.tb SecA2-dependent pathway and that
Petra Mlcochova et al.
Cell reports, 30(12), 3972-3980 (2020-03-27)
Macrophages exist predominantly in two distinct states, G0 and a G1-like state that is accompanied by phosphorylation of SAMHD1 at T592. Here, we demonstrate that Toll-like receptor 4 (TLR4) activation can potently induce G0 arrest and SAMHD1 antiretroviral activity by
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej