Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU025551

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CACCACTGGAACTGGACCTTCGTCATCAGCACCCTGCTCTTCTGCCTCATCGCCCGCGTGCTGGGGGTGCTGGGCCTGACCTGGTTCATCAACAAGTTCCGTATCGTGAAGCTGACCCCCAAGGACCAGTTCATCATCGCCTATGGGGGCCTGCGAGGGGCCATCGCCTTCTCTCTGGGCTACCTCCTGGACAAGAAGCACTTCCCCATGTGTGACCTGTTCCTCACTGCCATCATCACTGTCATCTTCTTCACCGTCTTTGTGCAGGGCATGACCATTCGGCCCCTGGTAGACCTGTTGGCTGTGAAGAAAAAGCAAGAGACGAAGCGCTCCATCAACGAAGAGATCCACACACAGTTCCTGGACCACCTTCTGACAGGCATCGAAGACATCTGTGGCCACTACGGTCACCACCACTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000090020

numer dostępu NCBI

NM_003047

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SLC9A1(6548) , SLC9A1(6548)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yosuke Ariyoshi et al.
Oncotarget, 8(2), 2209-2223 (2016-12-03)
Na+/H+ exchanger 1 (NHE1) is a plasma membrane transporter that controls intracellular pH and regulates apoptosis and invasion in various cancer cells. However, the function of NHE1 in esophageal squamous cell carcinoma (ESCC) cells and the relationship between the expression
Yogesh Singh et al.
The Journal of biological chemistry, 291(45), 23662-23671 (2016-09-16)
CD4
Zhenni Sun et al.
OncoTargets and therapy, 13, 8521-8532 (2020-09-10)
Several recent studies have addressed the role of Na+/H+ exchanger isoform 1 (NHE1) in tumor cell growth and apoptosis, including in gastric cancer. However, the role of NHE1 expression related to the 5-Fu resistance in gastric cancer has not been
A K Pedersen et al.
BMC cancer, 17(1), 542-542 (2017-08-16)
Chronic angiogenesis is a hallmark of most tumors and takes place in a hostile tumor microenvironment (TME) characterized by hypoxia, low nutrient and glucose levels, elevated lactate and low pH. Despite this, most studies addressing angiogenic signaling use hypoxia as
Raj R Malinda et al.
Frontiers in oncology, 10, 687-687 (2020-05-28)
Pancreatic ductal adenocarcinoma (PDAC) is a major cause of cancer-related death, with a 5-year survival of <10% and severely limited treatment options. PDAC hallmarks include profound metabolic acid production and aggressive local proliferation and invasiveness. This phenotype is supported by
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej