Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU019271

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCAC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000170323

numer dostępu NCBI

NM_001442

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FABP4(2167) , FABP4(2167)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ying Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 272-279 (2016-12-05)
FABP4 is widely expressed in both normal and pathologic tissues. It promotes cell proliferation, survival and migration of endothelial cells, and therefore, angiogenesis. However, the role of FABP4 in hemangioma or hemangioma endothelial cells (HemECs) has not been explored. In
Mingguo Huang et al.
Oncotarget, 8(67), 111780-111794 (2018-01-18)
Fatty acid binding protein 4 (FABP4) is an abundant protein in adipocytes, and its production is influenced by high-fat diet (HFD) or obesity. The prostate stromal microenvironment induces proinflammatory cytokine production, which is key for the development and progression of
Sanjay Basak et al.
Molecular and cellular biochemistry, 437(1-2), 55-64 (2017-06-18)
Adequate placental angiogenesis is critical for the establishment of the placental circulation and thus for normal feto-placental growth and development. Fatty acid-binding protein-4 (FABP4) plays a pro-angiogenic role in endothelial cells; however, very little information is available in placental first
Rebecca F Rogers et al.
Cancer research, 80(8), 1735-1747 (2020-03-13)
Checkpoint kinase 1 (CHK1) is a key mediator of the DNA damage response that regulates cell-cycle progression, DNA damage repair, and DNA replication. Small-molecule CHK1 inhibitors sensitize cancer cells to genotoxic agents and have shown single-agent preclinical activity in cancers
U Harjes et al.
Oncogene, 36(7), 912-921 (2016-08-30)
Fatty acid binding protein 4 (FABP4) is a fatty acid chaperone, which is induced during adipocyte differentiation. Previously we have shown that FABP4 in endothelial cells is induced by the NOTCH1 signalling pathway, the latter of which is involved in
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej