Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU018671

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGGAGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGATGAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAAACCATCCAGCATCCACCAAGTAATCGTGCATCG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000141646

numer dostępu NCBI

NM_005359

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SMAD4(4089) , SMAD4(4089)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
FDV
PCV
YBV
MOU
RNU

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mao Ding et al.
Journal of experimental & clinical cancer research : CR, 39(1), 28-28 (2020-02-06)
Sirtuin-7 (SIRT7) is associated with the maintenance of tumorigenesis. However, its functional roles and oncogenic mechanisms in prostate cancer (PCa) are poorly understood. Here, we investigated the roles and underlying molecular mechanisms of SIRT7 in PCa cell growth and androgen-induced
Ryotaro Ogawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(9), 2887-2899 (2019-02-02)
SMAD4 is a key transcriptional factor of TGFβ signaling and acts as a tumor suppressor in colorectal cancer. In the present study, we explored the immunologic effect of SMAD4 on the tumor microenvironment. Using 99 clinical specimens and human colorectal
Xiaojiang Tang et al.
Journal of cellular biochemistry, 121(11), 4642-4653 (2020-02-13)
As an aggressive breast cancer (BCa) subtype, triple-negative breast cancer (TNBC) responses poorly to chemotherapy and endocrine therapy, and usually has a worse prognosis. This is largely due to the lack of specific therapeutic targets, laying claim to an imperious
Danyang Chao et al.
Biochemical and biophysical research communications, 509(2), 535-540 (2019-01-02)
AZD3759 is a tyrosine kinase inhibitor and has an encouraging future in treating brain metastases of non-small cell lung cancer. Here, we determined that AZD3759 suppressed the viability of HepG2 cells, a hepatoma cell line, and induced their apoptosis, suggesting
Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej