Wszystkie zdjęcia(1)

Key Documents

Świadectwo pochodzenia/Certyfikat analizy (COA)

View All Documentation

EHU017501

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human CLDN1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:

41105324

NACRES:

NA.51

opis

linia produktu

MISSION^®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAAC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000163347

numer dostępu NCBI

NM_021101

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CLDN1(9076) , CLDN1(9076)

Powiązane kategorie

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Opis ogólny

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Methylation of the claudin 1 promoter is associated with loss of expression in estrogen receptor positive breast cancer.

Francescopaolo Di Cello et al.

PloS one, 8(7), e68630-e68630 (2013-07-12)

Downregulation of the tight junction protein claudin 1 is a frequent event in breast cancer and is associated with recurrence, metastasis, and reduced survival, suggesting a tumor suppressor role for this protein. Tumor suppressor genes are often epigenetically silenced in

Differential Expression and Function of Bicellular Tight Junctions in Skin and Oral Wound Healing.

Trevor R Leonardo et al.

International journal of molecular sciences, 21(8) (2020-04-29)

Bicellular tight junctions are multiprotein complexes that are required for maintenance of barrier function and fence function in epithelial tissues. Wound healing in the oral cavity leads to minimal scar formation compared to the skin, and the precise mechanisms for

Overexpression of microRNA-98 inhibits cell proliferation and promotes cell apoptosis via claudin-1 in human colorectal carcinoma.

Yi-Feng Zheng et al.

Journal of cellular biochemistry, 120(4), 6090-6105 (2018-12-07)

Colorectal carcinoma (CRC) is a major cause of cancer-related deaths worldwide, and investigations on novel targets are imperative. MiR-98 has been reported to act as a tumor suppressor in several cancers. To evaluate miR-98 as a novel anticancer molecule for

MicroRNA-142-5p contributes to Hashimoto's thyroiditis by targeting CLDN1.

Jin Zhu et al.

Journal of translational medicine, 14(1), 166-166 (2016-06-10)

MicroRNAs have the potential as diagnostic biomarkers and therapeutic targets in autoimmune diseases. However, very limited studies have evaluated the expression of microRNA profile in thyroid gland related to Hashimoto's thyroiditis (HT). MicroRNA microarray expression profiling was performed and validated

Increase in Toxicity of Anticancer Drugs by PMTPV, a Claudin-1-Binding Peptide, Mediated via Down-Regulation of Claudin-1 in Human Lung Adenocarcinoma A549 Cells.

Haruka Nasako et al.

International journal of molecular sciences, 21(16) (2020-08-23)

Claudin-1 (CLDN1), a tight junctional protein, is highly expressed in lung cancer cells and may contribute to chemoresistance. A drug which decreases CLDN1 expression could be a chemosensitizer for enhancing the efficacy of anticancer drugs, but there is no such

Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej