Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU014951

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRD1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCAATCAGAGAGATTCCAAGAAATATAGGAGAATTGAGAAATTTGGTTAGTTTACATGCATACAATAATCAAATAAGTTATCTTCCACCATCTTTGCTATCTTTAAATGATCTGCAGCAACTAAACCTGAGTGGAAATAATCTGACAGCTCTACCTAGTGCTATCTACAATATTTTTTCACTGAAGGAGATAAATTTTGATGACAACCCTTTGCTGAGACCTCCAGTGGAAATCTGTAAAGGAAAACAGTTGTATACTATTGCACGCTATCTACAGAGGGCAGATGAAAGAGATGAGAAAATTTTAGAGAAGATATTCAAGATAGTTGCCAACAACATCACTGAAACCAATTTTGAATTTTTATGTCAAAAACTAAACCTGGCAAACTCAGAAACTGATATGCCTACAAAGAGCACTGTTTCATTAAGTGAGAGAGCCCACCAAGCACTTGTTATATGGAAAACACAAAGTAACAAGTTATCACTAACTGCTGCTGCTTTAAGAGATCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000188693

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... LRRD1(401387) , NR4A3(8013)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Alexander J A Deutsch et al.
Cancer research, 77(9), 2375-2386 (2017-03-03)
Nuclear orphan receptor NR4A1 exerts an essential tumor suppressor function in aggressive lymphomas. In this study, we investigated the hypothesized contribution of the related NR4A family member NR4A3 to lymphomagenesis. In aggressive lymphoma patients, low expression of NR4A3 was associated
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into
Xiao-Jun Feng et al.
British journal of pharmacology, 172(11), 2852-2863 (2015-01-28)
The orphan nuclear receptor NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, and is involved in glucose and fat metabolism. However, its potential contribution to cardiovascular diseases remains to be assessed. Here, the roles of NOR1

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej