Przejdź do zawartości
Merck

EHU014011

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCAGTGCTGGAGATCATTGCCTTTCATTGCAAGAGCCCGCACCGACACCGAATGGTCGTTTTGGAGCCCCTGAACAAACTGCTGCAGGCGAAATGGGATCTGCTCATCCCCAAGTTCTTCTTAAACTTCCTGTGTAATCTGATCTACATGTTCATCTTCACCGCTGTTGCCTACCATCAGCCTACCCTGAAGAAGGGCGCCGCCCCTCACCTGAAAGCGGAGGTTGGAAACTCCATGCTGCTGACGGGCCACATCCTTATCCTGCTAGGGGGGATCTACCTCCTCGTGGGCCAGCTGTGGTACTTCTGGCGGCGCCACGTGTTCATCTGGATCTCGTTCATAGACAGCTACTTTGAAATCCTCTTCCTGTTCCAGGCCCTGCTCACAGTGGTGTCCCAGGTGCTGTGTTTCCTGGCCATCGAGTGGTACCTGCCCCTGCTTGTGTCTGCGCTGGTGCTGGGCTGGCTGAACCTGCTTTACTATACACGTGGCTTCCAGCACACAGGCATCTAC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Agathe Oulidi et al.
PloS one, 8(5), e64885-e64885 (2013-06-07)
Adrenomedullin (AM) is a 52-amino acid peptide initially isolated from human pheochromocytoma. AM is expressed in a variety of malignant tissues and cancer cell lines and was shown to be a mitogenic factor capable of stimulating growth of several cancer
Taro Ishii et al.
Journal of dermatological science, 90(3), 332-342 (2018-04-04)
Keratinocytes release several factors that are involved in wound contracture and scar formation. We previously reported that a three-dimensional reconstruction model derived from rat skin represents a good wound healing model. We characterized the role of transient receptor potential (TRP)
Michal Entin-Meer et al.
PloS one, 9(8), e105055-e105055 (2014-08-20)
A novel family of transient receptor potential (TRP) channels, that may hold a role in calcium homeostasis, has recently been described. By employing a GeneChip array analysis we have demonstrated a clear and specific upregulation of the TRP vanilloid 2
Matthew R Cohen et al.
PloS one, 8(12), e85392-e85392 (2014-01-07)
Transient receptor potential vanilloid 2 (TRPV2) is a Ca(2+)-permeable nonselective cation channel proposed to play a critical role in a wide array of cellular processes. Although TRPV2 surface expression was originally determined to be sensitive to growth factor signaling, regulated
Toshiaki Sawatani et al.
American journal of physiology. Cell physiology, 316(3), C434-C443 (2019-01-17)
β-Cell swelling induces membrane depolarization, which has been suggested to be caused at least partly by the activation of cation channels. Here, we show the identification of the cation channels. In isolated mouse pancreatic β-cells, the exposure to 30% hypotonic

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej