Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU013881

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIB3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGACTGCCCCCCTGCCTGTTGCCCCTGAGCCCACCTACTGCTCCAGATCGTGCAACTGCTGTGGCCACTGCCTCCCGTCTTGGGCCCTATGTCCTCCTGGAGCCCGAGGAGGGCGGGCGGGCCTACCAGGCCCTGCACTGCCCTACAGGCACTGAGTATACCTGCAAGGTGTACCCCGTCCAGGAAGCCCTGGCCGTGCTGGAGCCCTATGCGCGGCTGCCCCCGCACAAGCATGTGGCTCGGCCCACTGAGGTCCTGGCTGGTACCCAGCTCCTCTACGCCTTTTTCACTCGGACCCATGGGGACATGCACAGCCTGGTGCGAAGCCGCCACCGTATCCCTGAGCCTGAGGCTGCCGTGCTCTTCCGCCAGATGGCCACCGCCCTGGCGCACTGTCACCAGCACGGTCTGGTCCTGCGTGATCTCAAGCTGTGTCGCTTTGTCTTCGCTGACCGTGAGAGGAAGAAGCTGGTGCTGGAGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000101255

numer dostępu NCBI

NM_021158

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TRIB3(57761) , TRIB3(57761)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
JUU
QCS
NRR
RPR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Anna López-Plana et al.
International journal of cancer, 147(4), 1163-1179 (2020-01-17)
Around 40% of newly diagnosed lung cancer patients are Stage IV, where the improvement of survival and reduction of disease-related adverse events is the main goal for oncologists. In this scenario, we present preclinical evidence supporting the use of ABTL0812
Xin Hu et al.
International journal of molecular sciences, 21(4) (2020-02-20)
NCAPG is a subunit of condensin I that plays a crucial role in chromatin condensation during mitosis. NCAPG has been demonstrated to be associated with farm animal growth traits. However, its role in regulating myoblast differentiation is still unclear. We
Seong-Hoon Yun et al.
Oncotarget, 9(1), 495-511 (2018-02-09)
We previously demonstrated that the quinovose-containing hexaoside stichoposide C (STC) is a more potent anti-leukemic agent than the glucose-containing stichoposide D (STD), and that these substances have different molecular mechanisms of action. In the present study, we investigated the novel
Shuyi Wang et al.
Biochimica et biophysica acta, 1863(12), 3060-3074 (2017-09-25)
Endoplasmic reticulum (ER) stress has been demonstrated to prompt various cardiovascular risks although the underlying mechanism remains elusive. Protein tyrosine phosphatase-1B (PTP1B) serves as an essential negative regulator for insulin signaling. This study examined the role of PTP1B in ER
Yiteng Meng et al.
Digestive diseases and sciences, 64(8), 2167-2176 (2019-02-15)
The Tec kinase family is involved in acute and chronic inflammatory diseases, but its relationship with severe acute pancreatitis (SAP) remains unclear. To investigate whether Tec tyrosine kinase can be used as a target for severe acute pancreatitis-associated acute lung
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej