Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU012661

Sigma-Aldrich

MISSION® esiRNA

targeting human PEBP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATAGACCCACCAGCATTTCGTGGGATGGTCTTGATTCAGGGAAGCTCTACACCTTGGTCCTGACAGACCCGGATGCTCCCAGCAGGAAGGATCCCAAATACAGAGAATGGCATCATTTCCTGGTGGTCAACATGAAGGGCAATGACATCAGCAGTGGCACAGTCCTCTCCGATTATGTGGGCTCGGGGCCTCCCAAGGGCACAGGCCTCCACCGCTATGTCTGGCTGGTTTACGAGCAGGACAGGCCGCTAAAGTGTGACGAGCCCATCCTCAGCAACCGATCTGGAGACCACCGTGGCAAATTCAAGGTGGCGTCCTTCCGTAAAAAGTATGAGCTCAGGGCCCCGGTGGCTGGCACGTGTTACCAGGCCGAGTGGGATGACTATGTGCCCAAACTGTACGAGCAGCTGTCTGGGAAGTAGGGGGTTAGCTTGGGGACCTGAACTGTCCTGGAGGCCCCAAGCCATGTTCCCCAGTTCAGTGTTGCATGTATAATAGATTTCTCCTCTTCCTGCCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000089220

numer dostępu NCBI

NM_002567

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PEBP1(5037) , PEBP1(5037)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Andrey Kazakov et al.
Basic research in cardiology, 113(6), 42-42 (2018-09-08)
Fibrosis is a hallmark of maladaptive cardiac remodelling. Here we report that genome-wide quantitative trait locus (QTL) analyses in recombinant inbred mouse lines of C57BL/6 J and DBA2/J strains identified Raf Kinase Inhibitor Protein (RKIP) as genetic marker of fibrosis progression.
Yun Wang et al.
Oncology reports, 34(4), 2106-2114 (2015-08-05)
The Raf kinase inhibitor protein (RKIP) is a novel metastasis suppressor. RKIP was previously found to have low expression in a colorectal cancer (CRC) patient cohort by immunohistochemistry. However, the role of RKIP in CRC remains undetermined. In the present
Quanfang Huang et al.
Journal of cellular biochemistry, 120(4), 6168-6177 (2018-10-12)
The purpose of this study was to investigate the effect of Raf kinase inhibitor protein (RKIP) on the growth, apoptosis, invasion, and metastasis of human hepatic stellate cell line (LX-2). A recombinant plasmid (pcDNA3.1-RKIP) or RKIP-targeting small interfering RNA (siRNA)
Zixuan Gong et al.
Cancer management and research, 12, 9327-9338 (2020-10-17)
Much evidence unveils the significance of long non-coding RNAs (lncRNAs) in diverse cancers. This study was designed to clarify the function and mechanism of lncRNA GATA6 antisense RNA 1 (GATA6-AS1) in the progression of non-small cell lung cancer (NSCLC). GATA6-AS1
Hae Sook Noh et al.
Autophagy, 12(11), 2183-2196 (2016-11-02)
Autophagy plays a critical role in maintaining cell homeostasis in response to various stressors through protein conjugation and activation of lysosome-dependent degradation. MAP1LC3B/LC3B (microtubule- associated protein 1 light chain 3 β) is conjugated with phosphatidylethanolamine (PE) in the membranes and
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej