Przejdź do zawartości
Merck

EHU010531

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP9

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTGACAGCGACAAGAAGTGGGGCTTCTGCCCGGACCAAGGATACAGTTTGTTCCTCGTGGCGGCGCATGAGTTCGGCCACGCGCTGGGCTTAGATCATTCCTCAGTGCCGGAGGCGCTCATGTACCCTATGTACCGCTTCACTGAGGGGCCCCCCTTGCATAAGGACGACGTGAATGGCATCCGGCACCTCTATGGTCCTCGCCCTGAACCTGAGCCACGGCCTCCAACCACCACCACACCGCAGCCCACGGCTCCCCCGACGGTCTGCCCCACCGGACCCCCCACTGTCCACCCCTCAGAGCGCCCCACAGCTGGCCCCACAGGTCCCCCCTCAGCTGGCCCCACAGGTCCCCCCACTGCTGGCCCTTCTACGGCCACTACTGTGCCTTTGAGTCCGGTGGACGATGCCTGCAACGTGAACATCTTCGACG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jon M Florence et al.
PloS one, 12(2), e0171427-e0171427 (2017-02-07)
The atherosclerotic process begins when vascular endothelial cells undergo pro-inflammatory changes such as aberrant activation to dysfunctional phenotypes and apoptosis, leading to loss of vascular integrity. Our laboratory has demonstrated that exposure of mice to second hand smoke triggers an
Chih-Jie Shen et al.
Theranostics, 10(16), 7083-7099 (2020-07-10)
Background: Colorectal cancer (CRC) progression and related mortality are highly associated with metabolic disorders. However, the molecular mechanism involved in the regulation of hyperlipidemia-associated CRC metastasis remains unclear. This study aimed to investigate the effects of angiopoietin-like 4 (ANGPTL4) on
Haibin Lu et al.
American journal of translational research, 9(12), 5361-5374 (2018-01-10)
Tumor-associated neutrophils (TANs) promote metastasis of multiple cancers, including oral squamous cell carcinoma (OSCC). Melatonin (Mel) reportedly exerts anti-metastatic effects on OSCC. However, little is known about the anti-OSCC effects of Mel involved in TANs. In this study, intensive infiltration
Hang Lin et al.
FEBS open bio, 7(9), 1291-1301 (2017-09-15)
Dysregulation of sirtuin 6 (SIRT6) is actively involved in tumor progression. High levels of SIRT6 have been associated with hepatocellular carcinoma and non-small cell lung cancer, and SIRT6 facilitates growth and metastasis of cancer cells. However, the clinical significance and
Xue Bai et al.
OncoTargets and therapy, 10, 2837-2847 (2017-06-28)
Epithelial-mesenchymal transition (EMT) is thought to be a crucial event during the early metastasis of tumor cells. Transforming growth factor (TGF)-β1 is involved in the process of EMT in a variety of human malignancies. Matrix metalloproteinase (MMP)-9 plays an important

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej