Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU010121

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCGTTTTCATGACCTCCTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAGCATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAGATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAGAGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAAGAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATCAAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGAGAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAGAAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTGCTGAATGTCACTGAACTTACCCAGAATGCCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000115415

numer dostępu NCBI

NM_007315
NM_139266

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... STAT1(6772) , STAT1(6772)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Sophia Hatziieremia et al.
Molecular carcinogenesis, 55(11), 1667-1677 (2015-10-27)
STAT1 loss has previously been implicated in cell line studies to modify prostate cancer cell growth and survival, however the clinical significance of this has not previously been established. This study investigated if STAT1 loss was associated with patient outcome
Lan-Juan Zhao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(1-2), 77-90 (2016-11-18)
Signal transducer and activator of transcription (STAT) pathway plays an important role in antiviral efficacy of interferon alpha (IFN-α). IFN-α is the main therapeutic against hepatitis C virus (HCV) infection. We explored effects of IFN-α on HCV replication and antiviral
Makoto Fujii et al.
World journal of gastroenterology, 23(30), 5519-5529 (2017-08-31)
To investigate interleukin (IL)-26 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD) and the function of IL-26. Human colonic subepithelial myofibroblasts (SEMFs) were isolated from colon tissue surgically resected. The expression of IL-26 protein and its
Yonglei Liu et al.
Oncotarget, 8(24), 39559-39570 (2017-05-04)
Carcinoma associated fibroblasts (CAFs) play important roles in breast cancer development and progression. Recent studies show that microRNAs (miRNAs) are the main regulators in CAFs. MiR-29b is one of the significant down-regulated miRNAs in CAFs from the miRNA screening. The
Zhenhua Feng et al.
Apoptosis : an international journal on programmed cell death, 22(8), 1001-1012 (2017-06-12)
Steroid-induced avascular necrosis of the femoral head (SANFH) is a major limitation of long-term or excessive clinical administration of glucocorticoids. Fludarabine, which is a compound used to treat various hematological malignancies, such as chronic lymphocytic leukemia, acts by down-regulating signal
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej