Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU009931

Sigma-Aldrich

MISSION® esiRNA

targeting human BAMBI

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCAAAGGTGAAATTCGATGCTACTGTGATGCTGCCCACTGTGTAGCCACTGGTTATATGTGTAAATCTGAGCTCAGCGCCTGCTTCTCTAGACTTCTTGATCCTCAGAACTCAAATTCCCCACTCACCCATGGCTGCCTGGACTCTCTTGCAAGCACGACAGACATCTGCCAAGCCAAACAGGCCCGAAACCACTCTGGCACCACCATACCCACATTGGAATGCTGTCATGAAGACATGTGCAATTACAGAGGGCTGCACGATGTTCTCTCTCCTCCCAGGGGTGAGGCCTCAGGACAAGGAAACAGGTATCAGCATGATGGTAGCAGAAACCTTATCACCAAGGTGCAGGAGCTGACTTCTTCCAAAGAGTTGTGGTTCCGGGCAGCGGTCATTGCCGTGCCCATTGCTGGAGGGCTGATTTTAGTGTTGCTTATTATGTTGGCCCTGAGGATGCTTCGAAGTGAAAATAAGAGGCTGCAGGATCAGCGGCAACAGATGCTCTCCCGTTTGCACTACAGCTTTCACGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000095739

numer dostępu NCBI

NM_012342

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... BAMBI(25805) , BAMBI(25805)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
OAV
NZU
QCS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Zhao Wang et al.
OncoTargets and therapy, 13, 131-142 (2020-02-06)
Non-small cell lung cancer (NSCLC) is a common malignancy over the world. Previous report indicated that the plasmacytoma variant translocation 1 (PVT1) has been documented to function as an oncogene in various types of human cancers. However, the biological mechanism
Jingjing He et al.
Growth factors (Chur, Switzerland), 34(5-6), 210-216 (2017-02-18)
Fibroblast growth factor-1 (FGF-1) promotes differentiation of human preadipocytes into mature adipocytes via modulation of a BMP and Activin Membrane-Bound Inhibitor (BAMBI)/Peroxisome proliferator-activated receptor (PPARγ)-dependent network. Here, we combined transcriptomic and functional investigations to identify novel downstream effectors aligned with
Longbiao Yang et al.
Molecular medicine reports, 20(4), 3901-3909 (2019-09-06)
To investigate the role of microRNA (miR)‑519d‑3p in postoperative epidural scar formation and its regulation of the bone morphogenetic protein and activin membrane‑bound inhibitor (BAMBI), miR‑519d‑3p and BAMBI expression levels in the lumbar disc of patients who had undergone laminectomy
Long Bai et al.
Cellular signalling, 37, 52-61 (2017-06-05)
Bone morphogenetic protein and activin membrane-bound inhibitor (BAMBI) is a transforming growth factor β (TGF-β) type I receptor antagonist that negatively regulates TGF-β and bone morphogenetic protein (BMP) signaling. BAMBI has been shown to be regulated by TGF-β signaling; however
Christopher Grunseich et al.
Molecular cell, 69(3), 426-437 (2018-02-06)
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej