Przejdź do zawartości
Merck

EHU009611

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTGATTTTAATGGCCACATCTAATCTCATTTCACATGAAAGAAGAAGTATATTTTAGAAATTTGTTAATGAGAGTAAAAGAAAATAAATGTGTATAGCTCAGTTTGGATAATTGGTCAAACAATTTTTTATCCAGTAGTAAAATATGTAACCATTGTCCCAGTAAAGAAAAATAACAAAAGTTGTAAAATGTATATTCTCCCTTTTATATTGCATCTGCTGTTACCCAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Z-F Chen et al.
European review for medical and pharmacological sciences, 24(12), 6707-6715 (2020-07-08)
This study was designed to investigate whether microRNA-936 can be involved in the development of gastric cancer (GCa) by down-regulating FGF2 expression and activating the phosphatidylinositol 3-kinase/protein kinase B (P13K/Akt) signaling pathway. Quantitative polymerase chain reaction (qPCR) was carried out
Jingzhe Yang et al.
The Journal of surgical research, 259, 261-270 (2020-11-10)
Keloid is a benign fibroproliferative tumor of the skin caused by abnormal wound healing process after skin injury. Long noncoding RNAs have been reported to be involved in the development of keloid. However, the role and mechanism of nuclear enriched
Xiaori Huang et al.
Oncology letters, 17(3), 3425-3431 (2019-03-15)
Increasing number of microRNAs (miRNAs) have been reported to play an important role in the development and progression of non-small cell lung cancer (NSCLC). In particular, microRNA-497-5p (miR-497-5p) has been proposed as a tumor suppressor miRNA in human cancers. However
Long He et al.
Journal of cancer research and therapeutics, 14(7), 1519-1524 (2018-12-28)
The objective of the study is to investigate the role of basic fibroblast growth factor (bFGF) in sensitivity to cisplatin in non-small cell lung cancer (NSCLC) A549 cells and its effect on the stemness characteristics of NSCLC cells, revealing possible
Hongxue Wu et al.
Biochemical and biophysical research communications, 514(3), 933-939 (2019-05-16)
Cancer-associated fibroblasts comprise the major stromal cell populations in gastric cancer, which is a significant contributor to cancer-related death worldwide. As a member of the serine protease family, HTRA1 is reportedly involved in malignant transformation of various tumor types. In

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej