Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU005981

Sigma-Aldrich

MISSION® esiRNA

targeting human EPS8

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGAATGGCTACGGATCATCACCTACCTTTTCCCAGACGGACAGAGAACATGGTTCAAAAACAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGGGACAGTGTCAGCAGTGTGTCAGATATATCTCAATACCGTGTTGAACACTTGACTACCTTTGTCCTGGATCGGAAAGATGCTATGATCACTGTTGATGATGGAATAAGGAAATTGAAATTGCTTGATGCCAAGGGCAAAGTGTGGACTCAAGATATGATTCTTCAAGTGGATGACAGAGCTGTGAGCCTGATTGATTTAGAATCAAAGGCAAGTAATGAACTGGAGAATTTTCCTTTAAACACAATCCAGCACTGCCAAGCTGTGATGCATTCATGCAGCTATGATTCAGTTCTTGCACTGGTGTGCAAAGAGCCAACCCAGAACAAGCCAGAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000151491

numer dostępu NCBI

NM_004447

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... EPS8(2059) , EPS8(2059)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
DHT
QCS
DOR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jieyun Zhang et al.
Acta biochimica et biophysica Sinica, 52(3), 259-267 (2020-03-10)
Tumor metastasis is the main cause of treatment failure and death in patients with late stage of gastric cancer (GC). Studies showed that microRNAs (miRNAs) are important regulators in the process of tumor metastasis. In this study, we used miRNA
Huifang Lu et al.
Molecular medicine reports, 14(6), 4999-5006 (2016-11-15)
Epidermal growth factor receptor pathway substrate 8 (EPS8) is critical in the proliferation, progression and metastasis of solid and hematological types of cancer, and thus constitutes an ideal target for cancer immunotherapy. The present study aimed to identify human leukocyte antigen
Quan Yuan et al.
International journal of pharmaceutics, 557, 178-181 (2019-01-01)
We developed polyamidoamine dendrimers conjugated with epidermal growth factor (EGF) for use in receptor-mediated delivery of therapeutics to cancer cells. Here, we demonstrate the utility of this approach to inhibit proliferation and migration of head and neck squamous carcinoma cells
Haruhi Fukuhisa et al.
Journal of human genetics, 64(6), 521-534 (2019-03-13)
Our ongoing analyses identifying dysregulated microRNAs (miRNAs) and their controlled target RNAs have shed light on novel oncogenic pathways in pancreatic ductal adenocarcinoma (PDAC). The PDAC miRNA signature obtained by RNA sequencing showed that both strands of pre-miR-130b (miR-130b-5p, the
Elisa Cappellini et al.
Life sciences, 131, 30-36 (2015-04-22)
Eps8 is an actin-binding protein which has been proposed as a regulator of cancer cell motility and invasion. However, nothing much is known about its contribution to the invasive properties of endothelial cells (ECs), and more generally to angiogenesis. Expression

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej