Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

View All Documentation

EHU004761

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP27B1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGAAATTCTCGTGTCCCAGACAAAGACATTCATGTGGGTGACTATATTATCCCCAAAAATACGCTGGTCACTCTGTGTCACTATGCCACTTCAAGGGACCCTGCCCAGTTCCCAGAGCCAAATTCTTTTCGTCCAGCTCGCTGGCTGGGGGAGGGTCCCACCCCCCACCCATTTGCATCTCTTCCCTTTGGCTTTGGCAAGCGCAGCTGTATGGGGAGACGCCTGGCAGAGCTTGAATTGCAAATGGCTTTGGCCCAGATCCTAACACATTTTGAGGTGCAGCCTGAGCCAGGTGCGGCCCCAGTTAGACCCAAGACCCGGACTGTCCTGGTACCTGAAAGGAGCATCAACCTACAGTTTTTGGACAGATAGTCCCATGGAAAGAGACTGTCATCATCACCCTTTCATTCATCATAGGGATAAGATTTTTTGTAGGCACAAGACCAAGGTATACATCTTCCCCTAATGCCTATCTGACCAAACTGGATAGAACCACCATAGTGAAGTGTGAGGCGGCCCTGACCAATGTGTGAAGTATGCACTTGGCCTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000111012

numer dostępu NCBI

NM_000785

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CYP27B1(1594) , CYP27B1(1594)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hana Sustova et al.
Acta physiologica (Oxford, England), 226(3), e13269-e13269 (2019-03-06)
Loss of skeletal muscle is one of the main features of cancer cachexia. Vitamin D (VD) deficiency is associated with impairment of muscle mass and performance and is highly prevalent in cachectic patients; therefore, VD supplementation has been proposed to
Shuo Geng et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 26(5), 1145-1153 (2011-05-05)
1,25-Dihydroxyvitamin D(3)[1,25(OH)(2)D(3)] has many noncalcemic actions that rest on inhibition of proliferation and promotion of differentiation in malignant and normal cell types. 1,25(OH)(2)D(3) stimulates osteoblast differentiation of human marrow stromal cells (hMSCs), but little is known about the effects of
Kaining Liu et al.
PloS one, 7(6), e39878-e39878 (2012-07-05)
We previously demonstrated that 25-hydroxyvitamin D(3), the precursor of 1α,25-dihydroxyvitamin D(3), is abundant around periodontal soft tissues. Here we investigate whether 25-hydroxyvitamin D(3) is converted to 1α,25-dihydroxyvitamin D(3) in periodontal soft tissue cells and explore the possibility of an autocrine/paracrine
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej