Przejdź do zawartości
Merck

EHU004421

Sigma-Aldrich

MISSION® esiRNA

targeting human BMI1, COMMD3-BMI1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAAGATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAGAACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGATAAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGAAGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTAAAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCACTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGAGATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGCCCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAGTCTCCTCATCCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Fan Xu et al.
Experimental and therapeutic medicine, 14(3), 2216-2220 (2017-10-01)
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin
M Hiraki et al.
Oncogene, 36(20), 2791-2801 (2016-11-29)
B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1) is a component of the polycomb repressive complex 1 (PRC1) complex that is overexpressed in breast and other cancers, and promotes self-renewal of cancer stem-like cells. The oncogenic mucin 1 (MUC1)
M H Shahi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15107-15114 (2016-09-25)
Chemoresistance is a common hurdle for the proper treatment of gliomas. The role of Shh-Gli1 signaling in glioma progression has been reported. However, its role in glioma chemoresistance has not been well studied yet. In this work, we found that
Hexiang Wang et al.
Biochemical and biophysical research communications, 537, 22-28 (2021-01-01)
Triple-negative breast cancer (TNBC) is a major challenge in clinical practice due to its aggressiveness and lack of targeted treatment. Cancer stem-like traits contribute to tumorigenesis and immune privilege of TNBC. However, the relationship of stemness and immunosurveillance remains unclear.
Reigetsu Yoshikawa et al.
BMC cancer, 12, 461-461 (2012-10-11)
The polycomb group (PcG) family BMI1, acting downstream of the hedgehog (Hh) pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej