Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

View All Documentation

EHU002541

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL10

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGTCTAAAAGATCTCCTTAAAACCAGAGGGGAGCAAAATCGATGCAGTGCTTCCAAGGATGGACCACACAGAGGCTGCCTCTCCCATCACTTCCCTACATGGAGTATATGTCAAGCCATAATTGTTCTTAGTTTGCAGTTACACTAAAAGGTGACCAATGATGGTCACCAAATCAGCTGCTACTACTCCTGTAGGAAGGTTAATGTTCATCATCCTAAGCTATTCAGTAATAACTCTACCCTGGCACTATAATGTAAGCTCTACTGAGGTGCTATGTTCTTAGTGGATGTTCTGACCCTGCTTCAAATATTTCCCTCACCTTTCCCATCTTCCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000169245

numer dostępu NCBI

NM_001565

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CXCL10(3627) , CXCL10(3627)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yi Fu et al.
International immunopharmacology, 75, 105783-105783 (2019-08-04)
Myrothecine A, characterized from the extracts of myrothecium roridum strain IFB-E012, isolated as endophytic fungi found in the traditional Chinese medicinal plant Artemisia annua. Here we investigated its roles on anti-tumor and immune regulation in vitro. Dendritic cells (DCs) are
Katrina K Au et al.
Gynecologic oncology, 145(3), 436-445 (2017-03-21)
We recently established that high STAT1 expression and associated T helper type I tumour immune microenvironment (TME) are prognostic and chemotherapy response predictive biomarkers in high-grade serous ovarian cancer (HGSC). STAT1 induced chemokine CXCL10 is key to the recruitment of
Xiuming Wu et al.
Molecular and cellular endocrinology, 512, 110866-110866 (2020-05-18)
Although 70% of estrogen receptor (ER)-positive breast cancer patients can benefit from tamoxifen therapy, the rapid development of tamoxifen resistance hampers the treatment advantage. In this investigation, we found that the serum level of CXCL10 in breast cancer patients was
Jon Cogan et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 22(10), 1741-1752 (2014-08-27)
Patients with recessive dystrophic epidermolysis bullosa (RDEB) have severe, incurable skin fragility, blistering, and multiple skin wounds due to mutations in the gene encoding type VII collagen (C7), the major component of anchoring fibrils mediating epidermal-dermal adherence. Nearly 10-25% of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej