Przejdź do zawartości
Merck

EHU001471

Sigma-Aldrich

MISSION® esiRNA

targeting human AURKB

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Sun Lee et al.
Pathology oncology research : POR, 26(1), 453-459 (2018-11-14)
NOP53 ribosome biogenesis factor (NOP53) is a nucleolar protein involved in oncogenesis/tumor suppression, cell cycle regulation, and cell death. Here, we investigated the role of NOP53 in the maintenance of normal nuclear shape and chromosomal stability. Depletion of NOP53 by
Yan Guo et al.
American journal of cancer research, 10(10), 3458-3474 (2020-11-10)
Despite significant advances, skin cutaneous melanoma (SKCM) is a common life-threatening cancer worldwide. Recently, pseudogenes have been discovered to be functional in many physiological processes and the pathogenesis of various diseases, including cancer. However, their relevance to SKCM remains largely
Xiaolei Zhang et al.
Annals of translational medicine, 8(10), 646-646 (2020-06-23)
The modification and regulation of N6-methyladenosine (m6A) at mRNA level can affect the development and progression in various tumors. ALKBH5, as an m6A demethylase, plays different roles in tumors by regulating the m6A modification of mRNA. However, its role in
Lin Bao et al.
Journal of Cancer, 11(7), 1712-1726 (2020-03-21)
Purpose: To investigate the potential mechanisms contributing to metastasis of clear cell renal cell carcinoma (ccRCC), screen the hub genes, associated pathways of metastatic ccRCC and identify potential biomarkers. Methods: The ccRCC metastasis gene expression profile GSE47352 was employed to
Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej