콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU157921

Sigma-Aldrich

MISSION® esiRNA

targeting human TFE3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGAGGCTGCCCACACTACCGGCCCCACAGGCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAGAAGGAGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTGAGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAATTGAGCGTCGCAGGCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCCCTAAGTCCAGTGACCCGGAG

Ensembl | 인체 수납 번호

ENSG00000068323

NCBI 수납 번호

NM_006521

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TFE3(7030) , TFE3(7030)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Nunzia Pastore et al.
The EMBO journal, 38(12) (2019-05-28)
Autophagy and energy metabolism are known to follow a circadian pattern. However, it is unclear whether autophagy and the circadian clock are coordinated by common control mechanisms. Here, we show that the oscillation of autophagy genes is dependent on the
Na Zhang et al.
EBioMedicine, 40, 151-162 (2019-02-04)
Programmed death-ligand 1 (PD-L1) is a T-cell inhibitory checkpoint molecule that suppresses antitumor immunity. Anti-PD-L1 antibodies have shown remarkable promise in treating tumors, but the patient response rate is low. Therefore, small-molecule checkpoint inhibitors blocking PD-L1 function are urgently needed.
Chuanbin Yang et al.
Redox biology, 32, 101445-101445 (2020-02-11)
TFEB (transcription factor EB) and TFE3 (transcription factor E3) are "master regulators" of autophagy and lysosomal biogenesis. The stress response p38 mitogen-activated protein (MAP) kinases affect multiple intracellular responses including inflammation, cell growth, differentiation, cell death, senescence, tumorigenesis, and autophagy.
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and
Ikue Tai-Nagara et al.
Nature communications, 11(1), 6314-6314 (2020-12-11)
Blood and lymphatic vessels structurally bear a strong resemblance but never share a lumen, thus maintaining their distinct functions. Although lymphatic vessels initially arise from embryonic veins, the molecular mechanism that maintains separation of these two systems has not been

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.