콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU059261

Sigma-Aldrich

MISSION® esiRNA

targeting human TFEB

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCAC

Ensembl | 인체 수납 번호

ENSG00000112561

NCBI 수납 번호

NM_007162

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TFEB(7942) , TFEB(7942)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sijie Tan et al.
Scientific reports, 9(1), 727-727 (2019-01-27)
Mitochondrial dysfunction underscores aging and diseases. Mitophagy (mitochondria + autophagy) is a quality control pathway that preserves mitochondrial health by targeting damaged mitochondria for autophagic degradation. Hence, molecules or compounds that can augment mitophagy are therapeutic candidates to mitigate mitochondrial-related diseases. However
Valeria Crippa et al.
Scientific reports, 6, 22827-22827 (2016-03-11)
Neurodegenerative diseases (NDs) are often associated with the presence of misfolded protein inclusions. The chaperone HSPB8 is upregulated in mice, the human brain and muscle structures affected during NDs progression. HSPB8 exerts a potent pro-degradative activity on several misfolded proteins
Samuel Peña-Llopis et al.
The EMBO journal, 30(16), 3242-3258 (2011-08-02)
Mammalian target of rapamycin (mTOR) complex 1 (mTORC1) is an important, highly conserved, regulator of cell growth. Ancient among the signals that regulate mTORC1 are nutrients. Amino acids direct mTORC1 to the surface of the late endosome/lysosome, where mTORC1 becomes
Xingchen Zhao et al.
The Journal of pathology, 245(2), 235-248 (2018-03-24)
Insufficient autophagy in podocytes is related to podocyte injury in diabetic nephropathy (DN). Advanced glycation end-products (AGEs) are major factors of podocyte injury in DN. However, the role and mechanism of AGEs in autophagic dysfunction remain unknown. We investigated autophagic
Muzo Wu et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L138-L153 (2017-04-15)
Downregulation of the alveolar macrophage (AM) receptor with collagenous structure (MARCO) leads to susceptibility to postinfluenza bacterial pneumonia, a major cause of morbidity and mortality. We sought to determine whether immunomodulation of MARCO could improve host defense and resistance to
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.