콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU125271

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAUR

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484

구입 가능 여부는 고객센터에 문의하십시오.
모든 사진(1)

크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484

구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCTGAAGAACAGTGCCTGGATG

Ensembl | 인체 수납 번호

ENSG00000011422

NCBI 수납 번호

NM_001005376

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PLAUR(5329) , PLAUR(5329)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ZPT
WNS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xin Li et al.
Oncotarget, 8(51), 88645-88657 (2017-11-29)
Dissection and understanding of the molecular pathways driving triple-negative breast cancer (TNBC) are urgently needed to develop efficient tailored therapies. Aside from cell invasion and metastasis, the urokinase-type plasminogen activator receptor (uPAR) has been linked to apoptosis resistance in breast
Yohei Yamagami et al.
Biochemical and biophysical research communications, 525(3), 543-548 (2020-03-03)
There is increasing evidence that epithelial-mesenchymal transition (EMT) contributes to the development of organ fibrosis. We demonstrated that methotrexate (MTX) clearly induced EMT through the transforming growth factor (TGF)-β-related signaling pathway in human alveolar epithelial cell line, A549. However, critical
K D Rysenkova et al.
Cellular signalling, 75, 109741-109741 (2020-08-22)
Urokinase-type plasminogen activator uPA and its receptor (uPAR) are the central players in extracellular matrix proteolysis, which facilitates cancer invasion and metastasis. EGFR is one of the important components of uPAR interactome. uPAR/EGFR interaction controls signaling pathways that regulate cell
Xuexiang Gao et al.
Oncology letters, 16(3), 3983-3991 (2018-08-22)
Overexpression of urokinase-type plasminogen activator receptor (uPAR) has been implicated in promoting tumor invasion in various cancer types, including oral tongue squamous cell carcinoma (OTSCC); therefore, the effect of suppressing uPAR expression on the invasive and metastatic potential of OTSCC
Anna Laurenzana et al.
International journal of cancer, 141(6), 1190-1200 (2017-06-04)
In this manuscript, we show the involvement of the uPA/uPAR system in the regulation of aerobic glycolysis of melanoma cells. uPAR over-expression in human melanoma cells controls an invasive and glycolytic phenotype in normoxic conditions. uPAR down-regulation by siRNA or
모든 관련된 서류 보기

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.