콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU077471

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGA

Ensembl | 인체 수납 번호

ENSG00000105221

NCBI 수납 번호

NM_001626

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AKT2(208) , AKT2(208)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
LYU
JXU
UVU
JUU
IPU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wanmu Xie et al.
Journal of thrombosis and thrombolysis, 50(1), 98-111 (2020-05-03)
Venous thromboembolism (VTE) carries a high risk of morbidity and mortality. Understanding the mechanisms of venous thrombus formation and resolution is critical for improving VTE management. AKT2 kinase is essential for platelet activation and arterial thrombosis. In this study, we
Mohammad Imran Khan et al.
Molecular cancer therapeutics, 18(2), 356-363 (2018-11-18)
Hyperactivated AKT kinase due to loss of its negative regulator PTEN influences many aspects of cancer biology, including chromatin. AKT primarily regulates acetyl-CoA production and phosphorylates many histone-modulating enzymes, resulting in their activation or inhibition. Therefore, understanding the therapeutic impact
Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Yang Sun et al.
PloS one, 10(4), e0119783-e0119783 (2015-04-10)
Aberrant microRNA (miRNA) expression is associated with tumor development. This study aimed to elucidate the role of miR-615-5p in the development of pancreatic ductal adenocarcinoma (PDAC). Locked nucleic acid in situ hybridization (LNA-ISH) was performed to compare miR-615-5p expression in
Dineo Khabele et al.
Journal of Cancer, 5(8), 670-678 (2014-09-27)
Overexpression of the epidermal growth factor receptor (EGFR) is associated with the malignant phenotype in many cancers including ovarian cancer, which leads to increased cell proliferation and survival. In spite of emerging EGFR inhibitors as a potentially useful agent, they
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.