추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Farrukh Aqil et al.
Cancer letters, 449, 186-195 (2019-02-17)
Gene-silencing with targeted siRNAs has great potential as a therapeutic approach for various diseases including cancer. However, intracellular delivery of siRNA is challenging. We used bovine milk exosomes as a novel system for siRNA delivery. First, we demonstrated that exosomes
Gang Shen et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 798-809 (2018-10-12)
Bromodomain-containing protein 4 (BRD4) overexpression participates in prostate cancer progression by enhancing the transcriptional activity and expression of several key oncogenes. AZD5153 is a novel BRD4 inhibitor. Prostate cancer cells were treated with AZD5153. Cell survival was tested by MTT
Alexander Kretschmer et al.
Scientific reports, 9(1), 7826-7826 (2019-05-28)
Tunneling nanotubes (TNTs) are actin-based membranous structures bridging distant cells for intercellular communication. We define roles for TNTs in stress adaptation and treatment resistance in prostate cancer (PCa). Androgen receptor (AR) blockade and metabolic stress induce TNTs, but not in
Jun-Shan Liu et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 61, 152843-152843 (2019-05-01)
Hepatocellular carcinoma (HCC) ranks third among the most common causes of cancer-related deaths worldwide. The chemotherapy for HCC is still insufficient, so far. In searching for effective anti-HCC agents from traditional Chinese medicine, we discovered that aloperine (ALO), a quinolizidine
Sisi Chen et al.
Experimental hematology, 45, 74-84 (2016-10-25)
Although practiced clinically for more than 40 years, the use of hematopoietic stem cell (HSC) transplantation remains limited by the inability to expand functional HSCs ex vivo. To determine the role of phosphoinositide 3-kinase (PI3K)/AKT signaling in human hematopoietic stem and progenitor
문서
Quantitative and qualitative western blotting to validate knockdown by esiRNA.
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
