Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU146141

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF8

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Per informazioni sulla disponibilità, contatta il Servizio Clienti.


Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGACTTTGTCCTTTGTGGATTGCATAGCTGGATACCCATCATCTGTTTCTCTGATTGGAAGCTGCTGTTGTACAGAAAGACCTGCATTTCCCCCTTGTCTCCAGTTCTCTCACTACTTTTTCCTCCTCTGTGAGTGACCATCCAGGCAGTCACCATAACTGCTGGAGTGTCTGGGATTGGTAGCTCTCTCCAACTGCCTGCTTGCTCTTTACAGCCTCTCTCTGTGACTGGAATCTCTCCACCTCATCGTATCTAAGGATAACCCAGAAACATGGGGTGTCCTAGGTATGTTTATCTCGACACTGAACCCCCTAGGCTTCTGATGAATCCAGTGATTAGCTAAATTTGACATAGAAAGTAAGAAGGAATGTCTACTTTGTATTGTGGTCCTAATCTAAGATCAGGAGAATCCTGGAATTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lu Min et al.
Acta biochimica et biophysica Sinica, 51(8), 791-798 (2019-07-12)
MicroRNAs (miRNAs) are a class of endogenous noncoding genes that regulate gene expression at the posttranscriptional level. In recent decades, miRNAs have been reported to play important roles in tumor growth and metastasis, while some reported functions of a specific
Yoshiyuki Sasaki et al.
International journal of medical sciences, 10(9), 1231-1241 (2013-08-13)
The optimal timing of surgical resection of liver metastasis remains controversial, and guidelines regarding the upper limits of operative indications have not yet been defined. Surgical indication for metastasis from colorectal cancer (CLM) based on results of preoperative chemotherapy and
Justine Sitz et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(39), 19552-19562 (2019-09-11)
High-risk human papillomaviruses (HR-HPVs) promote cervical cancer as well as a subset of anogenital and head and neck cancers. Due to their limited coding capacity, HPVs hijack the host cell's DNA replication and repair machineries to replicate their own genomes.
Shengli Wang et al.
Biochimica et biophysica acta, 1863(6), 1615-1628 (2017-02-22)
The ring finger protein 8 (RNF8), a key component of protein complex crucial for DNA-damage response, consists of a forkhead-associated (FHA) domain and a really interesting new gene (RING) domain that enables it to function as an E3 ubiquitin ligase.
Maoxin Wang et al.
Oncology reports, 34(1), 341-349 (2015-05-09)
Tumor residue or recurrence is common after radiation therapy for nasopharyngeal cancer (NPC) since the tumor cells can repair irradiation-induced DNA damage. The ubiquitination cascade mediates the assembly of repair and signaling proteins at sites of DNA double-strand breaks (DSBs).

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.