Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU130921

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBI

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Huan He et al.
Oncogene, 37(19), 2586-2600 (2018-02-23)
A critical mechanism that has been proposed for transcription regulation by estrogen receptor α (ER) is the tethering of ER to DNA via other transcription factors, such as AP-1. However, genome-wide assessment of the overlap in chromatin binding repertoires of
Tianhong Pan et al.
Neoplasia (New York, N.Y.), 20(1), 32-43 (2017-12-01)
Bone metastasis is common in renal cell carcinoma (RCC), and the lesions are mainly osteolytic. The mechanism of bone destruction in RCC bone metastasis is unknown. We used a direct intrafemur injection of mice with bone-derived 786-O RCC cells (Bo-786)
Bingyan Li et al.
BMC cancer, 12, 239-239 (2012-06-15)
Transforming growth factor β induced (TGFBI) product, an extracellular matrix (ECM) protein, has been implicated as a putative tumor suppressor in recent studies. Our previous findings revealed that expression of TGFBI gene is down-regulated in a variety of cancer cell

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.