Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU130881

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATTCCCTTGGGAAATCTGAGGCAGATTATCTGACCTTTCCATCTGGGGAGTATGTTGCAGAAGAAATCTGTATTGCTGCTTCTAAAGCTTGTGGTATCACACCTGTGTATCATAATATGTTTGCTTTAATGAGTGAAACAGAAAGGATCTGGTATCCACCCAACCATGTCTTCCATATAGATGAGTCAACCAGGCATAATGTACTCTACAGAATAAGATTTTACTTTCCTCGTTGGTATTGCAGTGGCAGCAACAGAGCCTATCGGCATGGAATATCTCGAGGTGCTGAAGCTCCTCTTCTTGATGACTTTGTCATGTCTTACCTCTTTGCTCAGTGGCGGCATGATTTTGTGCACGGATGGATAAAAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGGATGGCAGT

N° accesso Ensembl | uomo

ENSG00000096968

N° accesso NCBI

NM_004972

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... JAK2(3717) , JAK2(3717)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Li-Xue Zou et al.
Cells, tissues, organs, 208(1-2), 13-24 (2020-02-12)
The aim of this work was to determine the effect of miR-375 on chondrocyte metabolism and oxidative stress in osteoarthritis (OA) mouse models through the JAK2/STAT3 signaling pathway. Chondrocytes were divided into control, IL-1β, IL-1β + miR-375 mimic, IL-1β +
Xiao-Guang Li et al.
EMBO reports, 20(6) (2019-05-16)
Intracellular tau accumulation forming neurofibrillary tangles is hallmark pathology of Alzheimer's disease (AD), but how tau accumulation induces synapse impairment is elusive. By overexpressing human full-length wild-type tau (termed hTau) to mimic tau abnormality as seen in the brain of
Wudian Xiao et al.
Microbial pathogenesis, 144, 104175-104175 (2020-04-01)
Trichophyton mentagrophytes (T. mentagrophytes) is the main cause of rabbit dermatophytosis. As the main pathogen-associated molecular pattern of T. mentagrophytes, the role of β-glucan in the pathogenesis of rabbit dermatophytosis remains elusive. Keratinocytes (KC) are the main cellular component and the first
Kong Chen et al.
Acta biochimica et biophysica Sinica, 52(8), 832-841 (2020-08-14)
Interleukin-5 (IL-5) is manifested as its involvement in the process of atherosclerosis, but the mechanism is still unknown. In this study, we explored the effect of IL-5 on lipid metabolism and its underlying mechanisms in THP-1-derived macrophages. The quantitative polymerase
Yuanyuan Zhou et al.
Journal of physiology and biochemistry, 73(2), 259-266 (2017-01-31)
The primary features of Alzheimer's disease (AD) are extracellular amyloid plaques consisting mainly of deposits of amyloid β (Aβ) peptides and intracellular neurofibrillary tangles (NFTs). Sets of evidence suggest that interleukin-5 (IL-5) is involved in the pathogenesis of AD. Herein
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.