Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU109681

Sigma-Aldrich

MISSION® esiRNA

targeting human DHX9

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGCTGGGCAGAAGGATTTTTGCACGAGAACATGGATCAAATAAGAAATTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAACTGTACCATCTTGGAGTGGTTGAAGCTTACTCCGGACTTACAAAGAAGAAGGAAGGAGAGACAGTGGAGCCTTACAAAGTAAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATTTTGCCCCCGCCTGAAGATCCTTCTGTGCCAGTTGCACTCAACATTGGCAAATTGGCTCAGTTCGAACCATCTCAGCGACAAAACCAAGTGGGTGTGGTTCCTTGGTCACCTCCACAATCCAACTGGAATCCTTGGACTAGTAGCAACATTGATGAGGGGCCTCTGGCTTTTGCTACTCC

N° accesso Ensembl | uomo

ENSG00000135829

N° accesso NCBI

NM_001357

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... DHX9(1660) , DHX9(1660)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wenmin Fu et al.
Journal of virology, 93(4) (2018-12-14)
Epstein-Barr virus (EBV) SM protein is an RNA-binding protein that has multiple posttranscriptional gene regulatory functions essential for EBV lytic replication. In this study, we identified an interaction between SM and DHX9, a DExH-box helicase family member, by mass spectrometry
Grace S Tan et al.
ACS chemical biology, 7(2), 403-410 (2011-10-27)
Argonaute proteins are the core components of the microRNP/RISC. The biogenesis and function of microRNAs and endo- and exo- siRNAs are regulated by Ago2, an Argonaute protein with RNA binding and nuclease activities. Currently, there are no in vitro assays
Jie Zhang et al.
Molecular medicine reports, 20(2), 1429-1435 (2019-06-08)
Pathological scarring is a result of the hypertrophy of scar tissue during tissue repair following trauma. The aim of the present study was to assess the effect of ubiquitin‑specific protease 4 (USP4) silencing on pathological scarring, and to evaluate the
Pratirodh Koirala et al.
Nature communications, 8, 14422-14422 (2017-02-09)
Despite the overwhelming number of human long non-coding RNAs (lncRNAs) reported so far, little is known about their physiological functions for the majority of them. The present study uses a CRISPR/Cas9-based synergistic activation mediator (SAM) system to identify potential lncRNAs
Lei Shi et al.
Nature communications, 12(1), 2038-2038 (2021-04-03)
Wild-type KRAS (KRASWT) amplification has been shown to be a secondary means of KRAS activation in cancer and associated with poor survival. Nevertheless, the precise role of KRASWT overexpression in lung cancer progression is largely unexplored. Here, we identify and
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.