Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU106951

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1B1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCGACCTGAAGCTGGACTACCTGGACCTCTACCTTATTCACTGGCCGACTGGCTTTAAGCCTGGGAAGGAATTTTTCCCATTGGATGAGTCGGGCAATGTGGTTCCCAGTGACACCAACATTCTGGACACGTGGGCGGCCATGGAAGAGCTGGTGGATGAAGGGCTGGTGAAAGCTATTGGCATCTCCAACTTCAACCATCTCCAGGTGGAGATGATCTTAAACAAACCTGGCTTGAAGTATAAGCCTGCAGTTAACCAGATTGAGTGCCACCCATATCTCACTCAGGAGAAGTTAATCCAGTACTGCCAGTCCAAAGGCATCGTGGTGACCGCCTACAGCCCCCTCGGCTCTCCTGACAGGCCCTGGGCCAAGCCCGAGGACCCTTCTCTCCTGGAGGATCCCAGGATCAAGGCGATCGCAGCCAAGCACAATAAAACTACAGCCCAGGTCCTGATCCGGTTCCCCATGCAGAGGAACTTGGTGGTGATCCCCAAGTCTGTGACA

N° accesso Ensembl | uomo

ENSG00000085662

N° accesso NCBI

NM_001628

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... AKR1B1(231) , AKR1B1(231)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ABV
CZU
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xuebiao Wu et al.
The Journal of experimental medicine, 214(4), 1065-1079 (2017-03-09)
Basal-like breast cancer (BLBC) is associated with high-grade, distant metastasis and poor prognosis. Elucidating the determinants of aggressiveness in BLBC may facilitate the development of novel interventions for this challenging disease. In this study, we show that aldo-keto reductase 1
Boel De Paepe et al.
Frontiers in neurology, 9, 846-846 (2018-10-27)
We recently identified osmolyte accumulators as novel biomarkers for chronic skeletal muscle inflammation and weakness, but their precise involvement in inflammatory myopathies remains elusive. In the current study, we demonstrate in vitro that, in myoblasts and myotubes exposed to pro-inflammatory
Pabitra B Pal et al.
Endocrinology, 158(10), 3661-3675 (2017-09-25)
Despite recent studies that show oxidative stress-generated reactive oxygen species (ROS) regulate NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome-mediated innate immune response in various diabetic complications, the mechanism by which ROS activate innate immune response is not well
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Visualizza tutti i documenti correlati

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.