Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU095251

Sigma-Aldrich

MISSION® esiRNA

targeting human MUC1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGTTCAGGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTGGCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ping Li et al.
International journal of clinical and experimental pathology, 8(9), 10365-10374 (2015-12-01)
Muc-1 is a member of the carbohydrate-binding protein family that contributes to neoplastic transformation, tumor survival, angiogenesis, and metastasis. The aim of this study is to investigate the role of muc-1 in human oral squamous cell carcinoma progression. In this
Satomi Shiba et al.
The Journal of surgical research, 238, 79-89 (2019-02-15)
Mucin1 (MUC1), a member of the mucin family, is a glycoprotein which is often expressed in malignant cells. However, the expression and function of MUC1 in human duodenal adenocarcinoma (DAC) has not yet been characterized because of its low frequency.
Mei Guo et al.
International immunopharmacology, 88, 106850-106850 (2020-08-11)
Targeted clearance of colorectal cancer stem cells (CCSCs) has become a novel strategy for tumor immunotherapy. Molecule mucin1 (MUC1) is one of targetable cell surface antigens in CCSCs. However, the critical role of MUC1 in anti-tumor effects of CCSC vaccine
Ashujit Tagde et al.
Oncotarget, 8(41), 69237-69249 (2017-10-21)
The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM
Dina Stroopinsky et al.
Journal of cellular and molecular medicine (2018-05-16)
Acute myeloid leukaemia (AML) is an aggressive haematological malignancy with an unmet need for improved therapies. Responses to standard cytotoxic therapy in AML are often transient because of the emergence of chemotherapy-resistant disease. The MUC1-C oncoprotein governs critical pathways of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.