Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU092941

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGEF2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGAATCCCTCATTGACGAAGAGGTAATCTACAGTGAGCTGATGAGTGACTTTGAGATGGATGAGAAGGACTTTGCAGCTGACTCTTGGAGTCTTGCTGTGGACAGCAGCTTCCTGCAGCAGCATAAAAAGGAGGTGATGAAGCAGCAAGATGTCATCTATGAGCTAATCCAGACAGAGCTGCACCATGTGAGGACACTGAAGATCATGACCCGCCTCTTCCGCACGGGGATGCTGGAAGAGCTACACTTGGAGCCAGGAGTGGTCCAGGGCCTGTTCCCCTGCGTGGACGAGCTCAGTGACATCCATACACGCTTCCTCAGCCAGCTATTAGAACGCCGACGCCAGGCCCTGTGCCCTGGCAGCACCCGGAACTTTGTCATCCATCGCTTGGGTGATCTGCTCATCAGCCAGTTCTCAGGTCCT

N° accesso Ensembl | uomo

ENSG00000116584

N° accesso NCBI

NM_004723

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ARHGEF2(9181) , ARHGEF2(9181)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
IYT
PBS
DHT
DUR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Michelle Rengarajan et al.
Molecular biology of the cell, 31(19), 2097-2106 (2020-06-26)
Interactions between host cells and individual pathogenic bacteria determine the clinical severity of disease during systemic infection in humans. Vascular endothelial cells, which line the lumen of blood vessels, represent a critical barrier for a bacterium in the bloodstream. These
Meng Pan et al.
Science advances, 6(31), eaaz1534-eaaz1534 (2020-08-14)
Microtubules display dynamic turnover during cell migration, leading to cell contractility and focal adhesion maturation regulated by Rho guanosine triphosphatase activity. This interplay between microtubules and actomyosin is mediated by guanine nucleotide exchange factor (GEF)-H1 released after microtubule depolymerization or
Juan José Sáez et al.
The Journal of cell biology, 218(7), 2247-2264 (2019-06-15)
B lymphocytes capture antigens from the surface of presenting cells by forming an immune synapse. Local secretion of lysosomes, which are guided to the synaptic membrane by centrosome repositioning, can facilitate the extraction of immobilized antigens. However, the molecular basis
Tony Y-C Tsai et al.
Developmental cell, 49(2), 189-205 (2019-04-25)
Efficient chemotaxis requires rapid coordination between different parts of the cell in response to changing directional cues. Here, we investigate the mechanism of front-rear coordination in chemotactic neutrophils. We find that changes in the protrusion rate at the cell front
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.